Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-181c-5p URS000018C928_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-181c: Hsa-mir-181c is a microRNA that is potentially involved in a positive feedback loop to activate the calcineurin/NFAT pathway by silencing the negative regulator of the pathway, CSNK1A1 [PMC5831902]. It has been found to have a significant positive correlation with kidney chromophobe (KICH), liver hepatocellular carcinoma (LIHC), and cholangiocarcinoma (CHOL), and a negative correlation with breast invasive carcinoma (BRCA) and lung squamous cell carcinoma (LUSC) [PMC7074167]. Hsa-mir-181c is part of the miR-181 family, which also includes miR-181a and miR-181b [PMC5831902]. It has been shown to be downregulated in hepatocellular carcinoma (HCC), lung cancer, and breast cancer [PMC7074167][PMC8914318][PMC5503581]. In addition, hsa-mir-181c has been found to be differentially expressed in tamoxifen-resistant and tamoxifen-sensitive breast cancer cell lines [PMC5820911]. Furthermore, hsa-mir-181c expression has been associated with response to platinum-based chemotherapy in cancer patients [PMC6359307]. Hsa-mir-181c has also been shown to exhibit differential expression in periapical and pulp tissues [PMC9987318]. Overall, hsa-mir-181c appears to play a role in various biological processes and may have potential as a biomarker or therapeutic target in cancer.

mRNA interactions 5 total

Genome locations

Gene Ontology annotations

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAACCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus cja-miR-181c
  2. Cricetulus griseus cgr-miR-181c-5p
  3. Daubentonia madagascariensis dma-miR-181c
  4. Gorilla gorilla gorilla ggo-miR-181c (MIR181C)
  5. Gorilla gorilla ggo-miR-181c
  6. Macaca mulatta (Rhesus monkey) mml-miR-181c-5p
  7. Mus musculus (house mouse) mmu-miR-181c-5p
  8. Pan paniscus ppa-miR-181c
  9. Pan troglodytes ptr-miR-181c
  10. Pongo pygmaeus ppy-miR-181c
  11. Rattus norvegicus (Norway rat) rno-miR-181c-5p
  12. Sus scrofa (pig) ssc-miR-181c
  13. Tupaia chinensis tch-miR-181c-5p
Publications