Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-181c URS000018C928_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-181c: Ssc-mir-181c is a microRNA that has been found to be down-regulated upon ZEN exposure, along with six other microRNAs, and up-regulated in the uterus but down-regulated in serum [PMC6722729] [PMC6598998]. It has been suggested that ssc-mir-181c, along with other members of the miR-181 family, plays a role in embryo implantation and placentation in pigs [PMC6598998]. Ssc-mir-181c has also been shown to decrease the translation level of CD163, a receptor involved in PRRSV infection, by binding to its mRNA [PMC9522899]. This binding inhibits PRRSV entry into porcine alveolar macrophages (PAMs) and suggests that ssc-mir-181c could be developed into therapeutics against PRRSV infection [PMC9522899]. Additionally, ssc-mir-181c has been found to have a higher expression level in blood monocytes compared to PAMs, indicating its potential role in suppressing PRRSV infection by targeting CD163 mRNA expression [PMC9522899]. Furthermore, ssc-mir-181c has been predicted to have binding sites on PPP1R10 and SLA-DRA genes [PMC3490867]. Overall, ssc-mir-181c is involved in various biological processes and may have potential implications for reproductive health and viral infections.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAACCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus cja-miR-181c
  2. Cricetulus griseus cgr-miR-181c-5p
  3. Daubentonia madagascariensis dma-miR-181c
  4. Gorilla gorilla gorilla ggo-miR-181c (MIR181C)
  5. Gorilla gorilla ggo-miR-181c
  6. Homo sapiens (human) hsa-miR-181c-5p
  7. Macaca mulatta (Rhesus monkey) mml-miR-181c-5p
  8. Mus musculus (house mouse) mmu-miR-181c-5p
  9. Pan paniscus ppa-miR-181c
  10. Pan troglodytes ptr-miR-181c
  11. Pongo pygmaeus ppy-miR-181c
  12. Rattus norvegicus (Norway rat) rno-miR-181c-5p
  13. Tupaia chinensis tch-miR-181c-5p
Publications