Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pongo pygmaeus (Bornean orangutan) ppy-miR-181c URS000018C928_9600

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAACCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus cja-miR-181c
  2. Cricetulus griseus cgr-miR-181c-5p
  3. Daubentonia madagascariensis dma-miR-181c
  4. Gorilla gorilla gorilla ggo-miR-181c (MIR181C)
  5. Gorilla gorilla ggo-miR-181c
  6. Homo sapiens (human) hsa-miR-181c-5p
  7. Macaca mulatta (Rhesus monkey) mml-miR-181c-5p
  8. Mus musculus (house mouse) mmu-miR-181c-5p
  9. Pan paniscus ppa-miR-181c
  10. Pan troglodytes ptr-miR-181c
  11. Rattus norvegicus (Norway rat) rno-miR-181c-5p
  12. Sus scrofa (pig) ssc-miR-181c
  13. Tupaia chinensis tch-miR-181c-5p