Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Tupaia chinensis (Chinese tree shrew) tch-miR-181c-5p URS000018C928_246437

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACAUUCAACCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-181c
  2. Cricetulus griseus cgr-miR-181c-5p
  3. Daubentonia madagascariensis (aye-aye) dma-miR-181c
  4. Gorilla gorilla gorilla ggo-miR-181c (MIR181C)
  5. Gorilla gorilla ggo-miR-181c
  6. Homo sapiens hsa-miR-181c-5p
  7. Macaca mulatta mml-miR-181c-5p
  8. Mus musculus (house mouse) mmu-miR-181c-5p
  9. Pan paniscus ppa-miR-181c
  10. Pan troglodytes ptr-miR-181c
  11. Pongo pygmaeus ppy-miR-181c
  12. Rattus norvegicus rno-miR-181c-5p
  13. Sus scrofa (pig) ssc-miR-181c
Relationships

Molecular Relationships

Publications