Rattus norvegicus (Norway rat) rno-miR-181c-5p URS000018C928_10116

• 22 nucleotides
• 3 databases (IntAct, miRBase, RefSeq)
• Found in 13 other species
• 86 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Localisation

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

AACAUUCAACCUGUCGGUGAGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

1. Callithrix jacchus cja-miR-181c
2. Cricetulus griseus cgr-miR-181c-5p
3. Daubentonia madagascariensis dma-miR-181c
4. Gorilla gorilla gorilla ggo-miR-181c (MIR181C)
5. Gorilla gorilla ggo-miR-181c
6. Homo sapiens (human) hsa-miR-181c-5p
7. Macaca mulatta (Rhesus monkey) mml-miR-181c-5p
8. Mus musculus (house mouse) mmu-miR-181c-5p
9. Pan paniscus ppa-miR-181c
10. Pan troglodytes ptr-miR-181c
11. Pongo pygmaeus ppy-miR-181c
12. Sus scrofa (pig) ssc-miR-181c
13. Tupaia chinensis tch-miR-181c-5p

Publications Download

• FASTA
• JSON