Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-150-5p URS000016FD1A_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (ENA, LncBase, miRBase, GeneCards, MalaCards, RefSeq, TarBase, MirGeneDB, IntAct). Described in 63 papers. Homo sapiens (human) hsa-miR-150-5p sequence is a product of miR-150, hsa-miR-150-5p, miR-150-5p, hsa-miR-150, MIR150 genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 209L8, 4EHP, ABC50, ABCF1, ABHD12, ABHD12A, ACKR3, ACO1, ADPRT, AGA.

Interactions 6

According to IntAct, Homo sapiens (human) hsa-miR-150-5p interacts with:

IntAct ID Participant Synonyms
EBI-25469630 intact:EBI-25469642 EBI-25469642 ENST00000341911 mrna_myb
EBI-25469635 intact:EBI-25469661 EBI-25469661 ENST00000264033 mrna_cbl-1
EBI-25469638 intact:EBI-25469684 EBI-25469684 ENST00000242480 mrna_egr2
EBI-25470905 intact:EBI-25470264 EBI-25470264 ENST00000403681 mrna_hmga2
EBI-25470925 intact:EBI-25470930 EBI-25470930 ENST00000349496 mrna_ctnnb1
EBI-25470915 intact:EBI-25470964 EBI-25470964 ENST00000556095 mrna_gskip

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCUCCCAACCCUUGUACCAGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 23 other species

    1. Alligator mississippiensis ami-miR-150-5p
    2. Anolis carolinensis aca-miR-150-5p
    3. Bos taurus (cattle) Bta-Mir-150_5p (mature (guide))
    4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-150
    5. Callorhinchus milii eshark_mir-150_1
    6. Canis lupus familiaris (dog) cfa-miR-150
    7. Capra hircus chi-miR-150
    8. Cavia porcellus (domestic guinea pig) cpo-miR-150-5p
    9. Cervus elaphus cel-miR-150
    10. Cricetulus griseus cgr-miR-150
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-150-5p
    12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-150_5p (mature (guide))
    13. Equus caballus eca-miR-150
    14. Gorilla gorilla (western gorilla) ggo-miR-150
    15. Macaca mulatta mml-miR-150-5p
    16. Mus musculus mmu-miR-150-5p
    17. Ovis aries oar-miR-150
    18. Pan troglodytes ptr-miR-150
    19. Pongo pygmaeus (Bornean orangutan) ppy-miR-150
    20. Python bivittatus pbv-miR-150-5p
    21. Rattus norvegicus rno-miR-150-5p
    22. Scyliorhinus torazame (cloudy catshark) Sto-Mir-150_5p (mature (guide))
    23. Sus scrofa (pig) ssc-miR-150
    24. Tursiops truncatus (common bottlenose dolphin) miR-150