Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) mml-miR-150-5p URS000016FD1A_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCCAACCCUUGUACCAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis ami-miR-150-5p
  2. Anolis carolinensis aca-miR-150-5p
  3. Bos taurus Bta-Mir-150_5p (mature (guide))
  4. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-150
  5. Callorhinchus milii Cmi-Mir-150_5p (mature (guide))
  6. Canis lupus familiaris cfa-miR-150
  7. Capra hircus chi-miR-150
  8. Cavia porcellus cpo-miR-150-5p
  9. Cervus elaphus cel-miR-150
  10. Cricetulus griseus cgr-miR-150
  11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-150-5p
  12. Echinops telfairi Ete-Mir-150_5p (mature (guide))
  13. Equus caballus eca-miR-150
  14. Gekko japonicus Gja-Mir-150_5p (mature (guide))
  15. Gorilla gorilla gorilla ggo-miR-150 (MIR150)
  16. Gorilla gorilla ggo-miR-150
  17. Homo sapiens hsa-miR-150-5p
  18. Microcaecilia unicolor Mun-Mir-150_5p (mature (guide))
  19. Mus musculus (house mouse) mmu-miR-150-5p
  20. Ovis aries oar-miR-150
  21. Pan troglodytes ptr-miR-150
  22. Pongo pygmaeus (Bornean orangutan) ppy-miR-150
  23. Python bivittatus (Burmese python) pbv-miR-150-5p
  24. Rattus norvegicus (Norway rat) rno-miR-150-5p
  25. Scyliorhinus torazame Sto-Mir-150_5p (mature (guide))
  26. Sphenodon punctatus (tuatara) Spt-Mir-150_5p (mature (guide))
  27. Sus scrofa ssc-miR-150
  28. Tursiops truncatus miR-150
Publications