Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-375 URS00000ED600_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-375: Ssc-mir-375 is a differentially expressed (DE) miRNA that has been studied in various contexts. In a study to validate sequencing results, ssc-mir-375 was one of the six DE miRNAs that were randomly selected for QPCR verification [PMC9996253]. It was also found to be one of the six common DE miRNAs in three pairs of samples [PMC7222822]. In the conserved region closest to the 3' UTR of the CHsx1401 genome, ssc-mir-375 was predicted to bind to it, along with other DE miRNAs [PMC10000162]. The study also predicted that ssc-mir-375 can bind to the most conserved fragment of the CHX1401 virus genome's 3' UTR, suggesting its potential role in regulating viral pathogenicity [PMC10000162]. The expression of ssc-mir-375 was found to be higher in the control group compared to the treatment group, as confirmed by qRT-PCR results [PMC10000162]. Additionally, it was found that ssc-mir-375 can simultaneously bind with other DE miRNAs to the CHsx1401 3' UTR [PMC10000162]. Overall, these findings highlight ssc-mir-375's involvement in various biological processes and its potential role in regulating viral pathogenicity.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUUCGUUCGGCUCGCGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (cattle) Bta-Mir-375_3p (mature (guide))
  2. Canis lupus familiaris (dog) cfa-miR-375
  3. Cavia porcellus cpo-miR-375-3p
  4. Cervus elaphus (red deer) Cel-miR-375
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-375-3p
  6. Echinops telfairi Ete-Mir-375_3p (mature (guide))
  7. Gorilla gorilla gorilla ggo-miR-375 (MIR375)
  8. Gorilla gorilla ggo-miR-375
  9. Homo sapiens (human) hsa-miR-375-3p
  10. Macaca mulatta mml-miR-375
  11. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-375_3p (mature (guide))
  12. Mus musculus mmu-miR-375-3p
  13. Ornithorhynchus anatinus (platypus) Oan-Mir-375_3p (mature (guide))
  14. Oryctolagus cuniculus (rabbit) ocu-miR-375-3p
  15. Pan troglodytes ptr-miR-375
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-375
  17. Pteropus alecto pal-miR-375-3p
  18. Ptychodera flava Pfl-Mir-375_3p (mature (guide))
  19. Rattus norvegicus (Norway rat) rno-miR-375-3p
  20. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-375_3p (mature (guide))
Publications