Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-375 URS00000ED600_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUUCGUUCGGCUCGCGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (cattle) Bta-Mir-375_3p (mature (guide))
  2. Canis lupus familiaris (dog) cfa-miR-375
  3. Cavia porcellus cpo-miR-375-3p
  4. Cervus elaphus (red deer) Cel-miR-375
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-375-3p
  6. Echinops telfairi Ete-Mir-375_3p (mature (guide))
  7. Gorilla gorilla gorilla ggo-miR-375 (MIR375)
  8. Gorilla gorilla ggo-miR-375
  9. Homo sapiens (human) hsa-miR-375-3p
  10. Macaca mulatta mml-miR-375
  11. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-375_3p (mature (guide))
  12. Mus musculus mmu-miR-375-3p
  13. Ornithorhynchus anatinus (platypus) Oan-Mir-375_3p (mature (guide))
  14. Oryctolagus cuniculus (rabbit) ocu-miR-375-3p
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-375
  16. Pteropus alecto pal-miR-375-3p
  17. Ptychodera flava Pfl-Mir-375_3p (mature (guide))
  18. Rattus norvegicus (Norway rat) rno-miR-375-3p
  19. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-375_3p (mature (guide))
  20. Sus scrofa (pig) ssc-miR-375
Publications