Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-375 URS00000ED600_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-375: Cfa-mir-375 is a microRNA that has been studied in relation to various heart diseases in dogs. It has been found to have moderate inverse correlations with plasma PIIINP concentration, along with other microRNAs such as cfa-miR-885, cfa-miR-211, cfa-miR-200c*, and cfa-miR-182 [PMC3668254]. In dogs with mitral valve disease (MMVD), cfa-mir-375 was significantly down-regulated compared to healthy dogs [PMC8062772]. It was also found to be upregulated in both eccentric and concentric cardiac hypertrophy groups, with a higher fold change in the concentric hypertrophy group [PMC8542680]. Cfa-mir-375 was identified as an accurate indicator associated with concentric cardiac hypertrophy [PMC8542680]. It showed significant positive correlations with left ventricular (LV) concentric hypertrophy indices such as left ventricular posterior wall thickness during diastole normalized (LVPWdN) and relative wall thickness (RWT) [PMC8542680]. Cfa-mir-375, along with cfa-let-7b, was able to distinguish dogs with concentric hypertrophy from those without it [PMC8542680]. However, the specificity of cfa-mir-375 for concentric cardiac hypertrophy was higher compared to that of cfa-let7b [PMC8542680]. Further research is needed to understand the expression and specific role of cfa-mir-375 in different types of cardiac hypertrophy in dogs [PMC8542680].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUUCGUUCGGCUCGCGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (cattle) Bta-Mir-375_3p (mature (guide))
  2. Cavia porcellus cpo-miR-375-3p
  3. Cervus elaphus (red deer) Cel-miR-375
  4. Dasypus novemcinctus (nine-banded armadillo) dno-miR-375-3p
  5. Echinops telfairi Ete-Mir-375_3p (mature (guide))
  6. Gorilla gorilla gorilla ggo-miR-375 (MIR375)
  7. Gorilla gorilla ggo-miR-375
  8. Homo sapiens (human) hsa-miR-375-3p
  9. Macaca mulatta mml-miR-375
  10. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-375_3p (mature (guide))
  11. Mus musculus mmu-miR-375-3p
  12. Ornithorhynchus anatinus (platypus) Oan-Mir-375_3p (mature (guide))
  13. Oryctolagus cuniculus (rabbit) ocu-miR-375-3p
  14. Pan troglodytes ptr-miR-375
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-375
  16. Pteropus alecto pal-miR-375-3p
  17. Ptychodera flava Pfl-Mir-375_3p (mature (guide))
  18. Rattus norvegicus (Norway rat) rno-miR-375-3p
  19. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-375_3p (mature (guide))
  20. Sus scrofa (pig) ssc-miR-375
Publications