Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-375-3p URS00000ED600_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-375: Rno-mir-375 is a miRNA that has been studied in various contexts. In F0-S dams, stress induced the expression of rno-mir-375, along with the suppression of rno-miR-145-3p, rno-miR-24-1-5p, and rno-mir-375 [PMC4244860]. In GK islets, the expression levels of rno-mir-375 were either higher than normal or completely different from normal levels [PMC3072418]. However, in GK islets, rno-mir-375 significantly increased at 16.7G [PMC3072418]. In Wistar islets stimulated at 16.7G compared to 2.8G, the expression levels of rno-mir-375 decreased [PMC3072418]. Rno-miR-124 and rno-miR1423p also showed similar trends in expression changes as rnomir375 in GK and Wistar islets [PMC3072418]. RnomiR375 was found to be non-differentially regulated in a negative control experiment [PMC3072418]. In rat beta-like INS1 cell line and human pancreas samples, rnomiR375 was found to be one of the most abundant miRNAs along with other miRNAs such as rat miR7p5p and rat miR26a5p [PMC10037588].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUUCGUUCGGCUCGCGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (cattle) Bta-Mir-375_3p (mature (guide))
  2. Canis lupus familiaris (dog) cfa-miR-375
  3. Cavia porcellus cpo-miR-375-3p
  4. Cervus elaphus (red deer) Cel-miR-375
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-375-3p
  6. Echinops telfairi Ete-Mir-375_3p (mature (guide))
  7. Gorilla gorilla gorilla ggo-miR-375 (MIR375)
  8. Gorilla gorilla ggo-miR-375
  9. Homo sapiens (human) hsa-miR-375-3p
  10. Macaca mulatta mml-miR-375
  11. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-375_3p (mature (guide))
  12. Mus musculus mmu-miR-375-3p
  13. Ornithorhynchus anatinus (platypus) Oan-Mir-375_3p (mature (guide))
  14. Oryctolagus cuniculus (rabbit) ocu-miR-375-3p
  15. Pan troglodytes ptr-miR-375
  16. Pongo pygmaeus (Bornean orangutan) ppy-miR-375
  17. Pteropus alecto pal-miR-375-3p
  18. Ptychodera flava Pfl-Mir-375_3p (mature (guide))
  19. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-375_3p (mature (guide))
  20. Sus scrofa (pig) ssc-miR-375
Publications