Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-375-3p URS00000ED600_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-375: Hsa-mir-375 is a microRNA that was investigated in a study comparing its expression in saliva and blood between two groups [PMC6679182]. The study aimed to identify a statistically significant difference in the expression of hsa-mir-375 and hsa-miR-34a-5p between the two groups [PMC6679182]. Additionally, hsa-mir-375 was found to be involved in gene ontology categories related to apoptosis, autophagy, and neurogenesis [PMC8463707]. Due to its involvement in these biological processes, along with hsa-let-7c-5p, the researchers focused on these two microRNAs and examined their KEGG pathways [PMC8463707]. The specific pathways associated with hsa-mir-375 were not mentioned in the given context. However, further investigation into these pathways may provide insights into the role of hsa-mir-375 in various biological processes. Overall, this research highlights the importance of studying microRNAs like hsa-mir-375 to better understand their involvement in cellular processes and potential implications for various diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUGUUCGUUCGGCUCGCGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 20 other species

  1. Bos taurus (cattle) Bta-Mir-375_3p (mature (guide))
  2. Canis lupus familiaris (dog) cfa-miR-375
  3. Cavia porcellus cpo-miR-375-3p
  4. Cervus elaphus (red deer) Cel-miR-375
  5. Dasypus novemcinctus (nine-banded armadillo) dno-miR-375-3p
  6. Echinops telfairi Ete-Mir-375_3p (mature (guide))
  7. Gorilla gorilla gorilla ggo-miR-375 (MIR375)
  8. Gorilla gorilla ggo-miR-375
  9. Macaca mulatta mml-miR-375
  10. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-375_3p (mature (guide))
  11. Mus musculus mmu-miR-375-3p
  12. Ornithorhynchus anatinus (platypus) Oan-Mir-375_3p (mature (guide))
  13. Oryctolagus cuniculus (rabbit) ocu-miR-375-3p
  14. Pan troglodytes ptr-miR-375
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-375
  16. Pteropus alecto pal-miR-375-3p
  17. Ptychodera flava Pfl-Mir-375_3p (mature (guide))
  18. Rattus norvegicus (Norway rat) rno-miR-375-3p
  19. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-375_3p (mature (guide))
  20. Sus scrofa (pig) ssc-miR-375
Publications