Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-200a URS000008DA94_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-200a: Eca-mir-200a is a microRNA that has been found to be overexpressed in old diseased mares compared to young diseased mares and control healthy mares [PMC8227551]. It is part of a group of microRNAs, including eca-miR-155, eca-miR-223, eca-miR-17, and eca-miR-205, that are overexpressed in both young and old diseased mares compared to control healthy mares [PMC8227551]. In particular, eca-mir-200a has been shown to have higher expression levels in old mares compared to young diseased mares and control mares [PMC8227551]. The expression profile of eca-mir-200a and other microRNAs was investigated in the serum of young and old aged mares with healthy and abnormal uterine status (endometritis) [PMC8227551]. These microRNAs have been found to target inflammatory immune response genes such as TRAF6, TNF╬▒, IL6, IL8, and IL10 [PMC8227551]. This study is the first to investigate the expression profile of these microRNAs in mare serum during endometritis [PMC8227551]. The relative abundance of eca-mir-200a was higher in both young and old diseased mares compared to control healthy mares [PMC8227551]. Eca-mir-200a has also been found to regulate the CDC25A gene involved in cell cycle regulation as well as the E2F3 gene [PMC9777602]. These findings suggest that eca-mir-200a could be a potential target for further research on endometritis treatment or diagnosis.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAACGAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Alligator mississippiensis (American alligator) ami-miR-200a-3p
  2. Anolis carolinensis aca-miR-200a-3p
  3. Capra hircus miR-200a
  4. Chiloscyllium plagiosum microRNA cpl-miR-200a
  5. Danio rerio dre-miR-200a-3p
  6. Gadus morhua gmo-miR-200a-3p
  7. Gallus gallus gga-miR-200a-3p
  8. Gorilla gorilla gorilla ggo-miR-200a (MIR200A)
  9. Gorilla gorilla ggo-miR-200a
  10. Homo sapiens hsa-miR-200a-3p
  11. Macaca mulatta mml-miR-200a-3p
  12. Monodelphis domestica mdo-miR-200a-3p
  13. Mus musculus (house mouse) mmu-miR-200a-3p
  14. Ovis aries miscellaneous RNA
  15. Pan troglodytes ptr-miR-200a
  16. Pongo pygmaeus ppy-miR-200a
  17. Rattus norvegicus (Norway rat) rno-miR-200a-3p
  18. Takifugu rubripes (torafugu) fru-miR-200a
  19. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-200a
  20. Tor tambroides (Thai mahseer) miR-200a-3p
  21. Xenopus tropicalis xtr-miR-200a
Publications