v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-30a-3p URS0000065D58_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-30a: ssc-mir-30a is a small RNA that is generated from the loop or the region between the loop and stem of its precursor molecule [PMC4008308]. This microRNA, along with others, has been observed to potentially originate from miRNA-offset RNAs (moRNAs), indicating a novel biogenesis pathway [PMC4001129]. In a study comparing castrated and intact male pigs, ssc-mir-30a was one of eight miRNAs that were validated and its expression levels were found to be lower in intact male pigs [PMC3901342]. However, in castrated male pigs, ssc-mir-30a levels were significantly increased in backfat tissue when compared with their intact counterparts [PMC3901342]. The study also highlighted ssc-mir-30a's role in targeting the AR gene, which could suggest its involvement in androgen receptor-related pathways or functions [PMC3901342].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 46 other species

  1. Alligator mississippiensis ami-miR-30a-3p
  2. Anolis carolinensis (green anole) aca-miR-30a-3p
  3. Bos taurus (domestic cattle) Bta-Mir-30-P1b_3p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-30-P1b_3p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-30-P1b_3p* (star (passenger))
  6. Canis lupus familiaris (dog) Cfa-Mir-30-P1b_3p* (star (passenger))
  7. Cavia porcellus cpo-miR-30a-3p
  8. Chrysemys picta bellii Cpi-Mir-30-P1b_3p* (star (passenger))
  9. Chrysemys picta (Painted turtle) cpi-miR-30a-3p
  10. Columba livia (rock pigeon) cli-miR-30a-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  12. Danio rerio dre-miR-30e-3p
  13. Dasypus novemcinctus dno-miR-30a-3p
  14. Echinops telfairi Ete-Mir-30-P1b_3p* (star (passenger))
  15. Gadus morhua (Atlantic cod) Gmo-Mir-30-P1b_3p* (star (passenger))
  16. Gallus gallus (chicken) gga-miR-30a-3p
  17. Gekko japonicus Gja-Mir-30-P1b_3p* (star (passenger))
  18. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  19. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
  20. Haplochromis burtoni abu-miR-30a-3p
  21. Homo sapiens hsa-miR-30a-3p
  22. Ictalurus punctatus (channel catfish) ipu-miR-30e
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-30-P1b_3p* (star (passenger))
  24. Loxodonta africana (African savanna elephant) Laf-Mir-30-P1b_3p* (star (passenger))
  25. Macaca mulatta mml-miR-30a-3p
  26. Microcaecilia unicolor Mun-Mir-30-P1b_3p* (star (passenger))
  27. Microcebus murinus (gray mouse lemur) Mmr-Mir-30-P1b_3p* (star (passenger))
  28. Monodelphis domestica Mdo-Mir-30-P1b_3p* (star (passenger))
  29. Monopterus albus (swamp eel) Mal-Mir-30-P1d_3p* (star (passenger))
  30. Mus musculus (house mouse) mmu-miR-30a-3p
  31. Ophiophagus hannah (king cobra) oha-miR-30a-3p
  32. Ornithorhynchus anatinus oan-miR-30a-3p
  33. Oryctolagus cuniculus ocu-miR-30a-3p
  34. Pan paniscus ppa-miR-30a-3p
  35. Pan troglodytes (chimpanzee) ptr-miR-30a-3p
  36. Pongo abelii (Sumatran orangutan) Pab-Mir-30-P1b_3p* (star (passenger))
  37. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
  38. Python bivittatus (Burmese python) pbv-miR-30a-3p
  39. Rattus norvegicus rno-miR-30a-3p
  40. Salmo salar ssa-miR-30d-3p
  41. Sarcophilus harrisii Sha-Mir-30-P1b_3p* (star (passenger))
  42. Sphenodon punctatus (tuatara) Spt-Mir-30-P1b_3p* (star (passenger))
  43. Taeniopygia guttata (zebra finch) Tgu-Mir-30-P1b_3p* (star (passenger))
  44. Tetraodon nigroviridis Tni-Mir-30-P1b_3p (mature (guide))
  45. Tor tambroides (Thai mahseer) miR-30e-3p
  46. Tursiops truncatus miR-30a-3p
 Relationships

Molecular Relationships

 Publications