Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gallus gallus (chicken) gga-miR-30a-3p URS0000065D58_9031

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

gga-mir-30a: gga-mir-30a is a microRNA (miRNA) that plays a significant role in the regulation of postnatal liver maturation in chickens, particularly by targeting the ESRP2 gene [PMC5758705]. This miRNA, along with gga-miR-30e, is highly expressed in the liver and is implicated in liver development [PMC5758705]. The gga-mir-30a sequence has been synthesized for research purposes and inserted into pmirGLO vectors to facilitate functional studies [PMC6406597]. It is also one of the top 20 miRNAs that are abundantly expressed in chicken somites, indicating its importance in chicken embryonic development [PMC4519947]. The gga-mir-30 family includes five members that share a common seed sequence but have unique 3′ ends, which allows them to target a slightly different set of genes [PMC7936154]. Specifically, gga-mir-30a has been found to influence skeletal muscle development by inhibiting myoblast proliferation during chick embryogenesis [PMC7936154]. Among differentially expressed miRNAs identified in Gallus gallus, gga-mir-30a was noted as the highest differentially expressed one, underscoring its significant regulatory role [PMC5214674].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 46 other species

  1. Alligator mississippiensis ami-miR-30a-3p
  2. Anolis carolinensis (green anole) aca-miR-30a-3p
  3. Bos taurus (domestic cattle) Bta-Mir-30-P1b_3p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-30-P1b_3p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-30-P1b_3p* (star (passenger))
  6. Canis lupus familiaris (dog) Cfa-Mir-30-P1b_3p* (star (passenger))
  7. Cavia porcellus cpo-miR-30a-3p
  8. Chrysemys picta bellii Cpi-Mir-30-P1b_3p* (star (passenger))
  9. Chrysemys picta (Painted turtle) cpi-miR-30a-3p
  10. Columba livia (rock pigeon) cli-miR-30a-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  12. Danio rerio dre-miR-30e-3p
  13. Dasypus novemcinctus dno-miR-30a-3p
  14. Echinops telfairi Ete-Mir-30-P1b_3p* (star (passenger))
  15. Gadus morhua (Atlantic cod) Gmo-Mir-30-P1b_3p* (star (passenger))
  16. Gekko japonicus Gja-Mir-30-P1b_3p* (star (passenger))
  17. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  18. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
  19. Haplochromis burtoni abu-miR-30a-3p
  20. Homo sapiens hsa-miR-30a-3p
  21. Ictalurus punctatus (channel catfish) ipu-miR-30e
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-30-P1b_3p* (star (passenger))
  23. Loxodonta africana (African savanna elephant) Laf-Mir-30-P1b_3p* (star (passenger))
  24. Macaca mulatta mml-miR-30a-3p
  25. Microcaecilia unicolor Mun-Mir-30-P1b_3p* (star (passenger))
  26. Microcebus murinus (gray mouse lemur) Mmr-Mir-30-P1b_3p* (star (passenger))
  27. Monodelphis domestica Mdo-Mir-30-P1b_3p* (star (passenger))
  28. Monopterus albus (swamp eel) Mal-Mir-30-P1d_3p* (star (passenger))
  29. Mus musculus (house mouse) mmu-miR-30a-3p
  30. Ophiophagus hannah (king cobra) oha-miR-30a-3p
  31. Ornithorhynchus anatinus oan-miR-30a-3p
  32. Oryctolagus cuniculus ocu-miR-30a-3p
  33. Pan paniscus ppa-miR-30a-3p
  34. Pan troglodytes (chimpanzee) ptr-miR-30a-3p
  35. Pongo abelii (Sumatran orangutan) Pab-Mir-30-P1b_3p* (star (passenger))
  36. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
  37. Python bivittatus (Burmese python) pbv-miR-30a-3p
  38. Rattus norvegicus rno-miR-30a-3p
  39. Salmo salar ssa-miR-30d-3p
  40. Sarcophilus harrisii Sha-Mir-30-P1b_3p* (star (passenger))
  41. Sphenodon punctatus (tuatara) Spt-Mir-30-P1b_3p* (star (passenger))
  42. Sus scrofa (pig) ssc-miR-30a-3p
  43. Taeniopygia guttata (zebra finch) Tgu-Mir-30-P1b_3p* (star (passenger))
  44. Tetraodon nigroviridis Tni-Mir-30-P1b_3p (mature (guide))
  45. Tor tambroides (Thai mahseer) miR-30e-3p
  46. Tursiops truncatus miR-30a-3p
Relationships

Molecular Relationships

Publications