Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-30a-3p URS0000065D58_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-30a: mmu-mir-30a is a microRNA that has been observed to be down-regulated in high-fat diet (HFD)-induced obesity in mice [PMC3319598]. Consistent with microarray data, RT-PCR results confirmed the downregulation of mmu-mir-30a in the context of obesity [PMC4346489]. This microRNA was also found to be differentially expressed in both plasma and aorta samples, indicating its potential role in atherosclerotic disease [PMC4346489]. Furthermore, mmu-mir-30a has been implicated in the regulation of brain-derived neurotrophic factor (BDNF) through direct targeting of its 3′UTR [PMC9120625]. In studies related to atherosclerotic vascular disease (ASVD), mmu-mir-30a was found to have a functional role through indirect regulation of SOCS3 and was significantly lower expressed in apoE−/− aortic tissues compared with healthy controls [PMC3641397]. Additionally, mmu-mir-30a expression was decreased in the prefrontal cortex and hippocampus of aged rats and is involved with innate immune system gene regulation [PMC6704709]. The regulatory elements for mmu-mir-30a have been identified, providing insights into its transcriptional control mechanisms [PMC6764145]. Lastly, alterations in mmu-mir-30a expression have been associated with liver regeneration processes and abnormal podocyte morphology when deficient [PMC9198802; PMC6032378].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 46 other species

  1. Alligator mississippiensis ami-miR-30a-3p
  2. Anolis carolinensis (green anole) aca-miR-30a-3p
  3. Bos taurus (domestic cattle) Bta-Mir-30-P1b_3p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-30-P1b_3p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-30-P1b_3p* (star (passenger))
  6. Canis lupus familiaris (dog) Cfa-Mir-30-P1b_3p* (star (passenger))
  7. Cavia porcellus cpo-miR-30a-3p
  8. Chrysemys picta bellii Cpi-Mir-30-P1b_3p* (star (passenger))
  9. Chrysemys picta (Painted turtle) cpi-miR-30a-3p
  10. Columba livia (rock pigeon) cli-miR-30a-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  12. Danio rerio dre-miR-30e-3p
  13. Dasypus novemcinctus dno-miR-30a-3p
  14. Echinops telfairi Ete-Mir-30-P1b_3p* (star (passenger))
  15. Gadus morhua (Atlantic cod) Gmo-Mir-30-P1b_3p* (star (passenger))
  16. Gallus gallus (chicken) gga-miR-30a-3p
  17. Gekko japonicus Gja-Mir-30-P1b_3p* (star (passenger))
  18. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  19. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
  20. Haplochromis burtoni abu-miR-30a-3p
  21. Homo sapiens hsa-miR-30a-3p
  22. Ictalurus punctatus (channel catfish) ipu-miR-30e
  23. Lepisosteus oculatus (spotted gar) Loc-Mir-30-P1b_3p* (star (passenger))
  24. Loxodonta africana (African savanna elephant) Laf-Mir-30-P1b_3p* (star (passenger))
  25. Macaca mulatta mml-miR-30a-3p
  26. Microcaecilia unicolor Mun-Mir-30-P1b_3p* (star (passenger))
  27. Microcebus murinus (gray mouse lemur) Mmr-Mir-30-P1b_3p* (star (passenger))
  28. Monodelphis domestica Mdo-Mir-30-P1b_3p* (star (passenger))
  29. Monopterus albus (swamp eel) Mal-Mir-30-P1d_3p* (star (passenger))
  30. Ophiophagus hannah (king cobra) oha-miR-30a-3p
  31. Ornithorhynchus anatinus oan-miR-30a-3p
  32. Oryctolagus cuniculus ocu-miR-30a-3p
  33. Pan paniscus ppa-miR-30a-3p
  34. Pan troglodytes (chimpanzee) ptr-miR-30a-3p
  35. Pongo abelii (Sumatran orangutan) Pab-Mir-30-P1b_3p* (star (passenger))
  36. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
  37. Python bivittatus (Burmese python) pbv-miR-30a-3p
  38. Rattus norvegicus rno-miR-30a-3p
  39. Salmo salar ssa-miR-30d-3p
  40. Sarcophilus harrisii Sha-Mir-30-P1b_3p* (star (passenger))
  41. Sphenodon punctatus (tuatara) Spt-Mir-30-P1b_3p* (star (passenger))
  42. Sus scrofa (pig) ssc-miR-30a-3p
  43. Taeniopygia guttata (zebra finch) Tgu-Mir-30-P1b_3p* (star (passenger))
  44. Tetraodon nigroviridis Tni-Mir-30-P1b_3p (mature (guide))
  45. Tor tambroides (Thai mahseer) miR-30e-3p
  46. Tursiops truncatus miR-30a-3p
Relationships

Molecular Relationships

GoFlow Results Publications