v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30a-3p URS0000065D58_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-30a: Hsa-mir-30a is a microRNA that exhibits differential expression in various human cancers, indicating its potential role in cancer biology [PMC5823624]. It was identified as a key component in the TF-miRNA-TG_B network, which is significant for understanding the regulatory mechanisms in cancer [PMC8576023]. Specifically, hsa-mir-30a was found to be downregulated in ectopic pregnancy (EP) tissues when compared to voluntary termination of pregnancy (VTOP) samples, as revealed by microarray studies [PMC4094496]. This downregulation suggests that hsa-mir-30a may have a role in the pathophysiology of ectopic pregnancies, although its exact function and mechanisms require further investigation [PMC4094496].

mRNA interactions 25 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 46 other species

  1. Alligator mississippiensis ami-miR-30a-3p
  2. Anolis carolinensis (green anole) aca-miR-30a-3p
  3. Bos taurus (domestic cattle) Bta-Mir-30-P1b_3p* (star (passenger))
  4. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-30-P1b_3p (mature (guide))
  5. Callorhinchus milii (elephant shark) Cmi-Mir-30-P1b_3p* (star (passenger))
  6. Canis lupus familiaris (dog) Cfa-Mir-30-P1b_3p* (star (passenger))
  7. Cavia porcellus cpo-miR-30a-3p
  8. Chrysemys picta bellii Cpi-Mir-30-P1b_3p* (star (passenger))
  9. Chrysemys picta (Painted turtle) cpi-miR-30a-3p
  10. Columba livia (rock pigeon) cli-miR-30a-3p
  11. Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p
  12. Danio rerio dre-miR-30e-3p
  13. Dasypus novemcinctus dno-miR-30a-3p
  14. Echinops telfairi Ete-Mir-30-P1b_3p* (star (passenger))
  15. Gadus morhua (Atlantic cod) Gmo-Mir-30-P1b_3p* (star (passenger))
  16. Gallus gallus (chicken) gga-miR-30a-3p
  17. Gekko japonicus Gja-Mir-30-P1b_3p* (star (passenger))
  18. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  19. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
  20. Haplochromis burtoni abu-miR-30a-3p
  21. Ictalurus punctatus (channel catfish) ipu-miR-30e
  22. Lepisosteus oculatus (spotted gar) Loc-Mir-30-P1b_3p* (star (passenger))
  23. Loxodonta africana (African savanna elephant) Laf-Mir-30-P1b_3p* (star (passenger))
  24. Macaca mulatta mml-miR-30a-3p
  25. Microcaecilia unicolor Mun-Mir-30-P1b_3p* (star (passenger))
  26. Microcebus murinus (gray mouse lemur) Mmr-Mir-30-P1b_3p* (star (passenger))
  27. Monodelphis domestica Mdo-Mir-30-P1b_3p* (star (passenger))
  28. Monopterus albus (swamp eel) Mal-Mir-30-P1d_3p* (star (passenger))
  29. Mus musculus (house mouse) mmu-miR-30a-3p
  30. Ophiophagus hannah (king cobra) oha-miR-30a-3p
  31. Ornithorhynchus anatinus oan-miR-30a-3p
  32. Oryctolagus cuniculus ocu-miR-30a-3p
  33. Pan paniscus ppa-miR-30a-3p
  34. Pan troglodytes (chimpanzee) ptr-miR-30a-3p
  35. Pongo abelii (Sumatran orangutan) Pab-Mir-30-P1b_3p* (star (passenger))
  36. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
  37. Python bivittatus (Burmese python) pbv-miR-30a-3p
  38. Rattus norvegicus rno-miR-30a-3p
  39. Salmo salar ssa-miR-30d-3p
  40. Sarcophilus harrisii Sha-Mir-30-P1b_3p* (star (passenger))
  41. Sphenodon punctatus (tuatara) Spt-Mir-30-P1b_3p* (star (passenger))
  42. Sus scrofa (pig) ssc-miR-30a-3p
  43. Taeniopygia guttata (zebra finch) Tgu-Mir-30-P1b_3p* (star (passenger))
  44. Tetraodon nigroviridis Tni-Mir-30-P1b_3p (mature (guide))
  45. Tor tambroides (Thai mahseer) miR-30e-3p
  46. Tursiops truncatus miR-30a-3p
 Relationships

Molecular Relationships

 Publications