Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-30a-3p URS0000065D58_10029

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUUUCAGUCGGAUGUUUGCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 28 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30a-3p
  2. Anolis carolinensis aca-miR-30a-3p
  3. Cavia porcellus cpo-miR-30a-3p
  4. Chrysemys picta cpi-miR-30a-3p
  5. Columba livia (rock pigeon) cli-miR-30a-3p
  6. Danio rerio dre-miR-30e-3p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30a-3p
  8. Gallus gallus (chicken) gga-miR-30a-3p
  9. Gorilla gorilla gorilla ggo-miR-30a-3p (MIR30A)
  10. Gorilla gorilla (western gorilla) ggo-miR-30a-3p
  11. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-30a-3p
  12. Homo sapiens hsa-miR-30a-3p
  13. Ictalurus punctatus ipu-miR-30e
  14. Macaca mulatta (Rhesus monkey) mml-miR-30a-3p
  15. Mus musculus (house mouse) mmu-miR-30a-3p
  16. Ophiophagus hannah oha-miR-30a-3p
  17. Ornithorhynchus anatinus oan-miR-30a-3p
  18. Oryctolagus cuniculus ocu-miR-30a-3p
  19. Pan paniscus (pygmy chimpanzee) ppa-miR-30a-3p
  20. Pan troglodytes ptr-miR-30a-3p
  21. Pongo pygmaeus (Bornean orangutan) ppy-miR-30a-3p
  22. Python bivittatus pbv-miR-30a-3p
  23. Rattus norvegicus (Norway rat) rno-miR-30a-3p
  24. Salmo salar ssa-miR-30d-3p
  25. Sus scrofa (pig) ssc-miR-30a-3p
  26. Tetraodon nigroviridis Tni-Mir-30-P1b_3p (mature (guide))
  27. Tor tambroides miR-30e-3p
  28. Tursiops truncatus miR-30a-3p
Publications