Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-495 URS000005A8ED_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-495: Rno-mir-495 is one of the twelve different types of miRNAs identified, including rno-miR-125b-5p, rno-miR-144-3p, rno-miR-24-3p, and novel-rno-miR-335-5p [PMC8529377]. In a study on fetal rats with anorectal malformations (ARMs), the expression of rno-mir-495 was found to be altered in the terminal hindgut [PMC6203938]. This miRNA is involved in feed-forward loops that amplify or inhibit the Fgf, Bmp, and Wnt signaling pathways implicated in the pathogenesis of ARMs [PMC6203938]. Additionally, several other miRNAs were also found to be altered in ARM fetal rats and involved in these signaling pathways [PMC6203938]. Among the predicted altered mRNAs associated with these miRNAs, Calml4 was found to correspond with six changed miRNAs including rno-mir-495 [PMC8529377]. Another mRNA, Acvr1c, corresponded with several other miRNAs including rno-mir-495 [PMC8529377]. In a study comparing different treatment groups for a liver-benefiting and rectifying decoction (LBRD), it was observed that rno-mir-495 was down-regulated in the LBRD treated group compared to the model group. This down-regulation predicted an up-regulation of target mRNAs such as GAT3, Calml4, Tnfaip6, Arc Gad1 and BDNF [PMC8529377].

mRNA interactions 8 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACAAACAUGGUGCACUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-495
  2. Callithrix jacchus cja-miR-495
  3. Canis lupus familiaris (dog) cfa-miR-495
  4. Capra hircus (goat) chi-miR-495-3p
  5. Cavia porcellus cpo-miR-495-3p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-495-3p
  7. Echinops telfairi Ete-Mir-154-P19_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-495
  9. Homo sapiens hsa-miR-495-3p
  10. Macaca mulatta (Rhesus monkey) mml-miR-495-3p
  11. Mus musculus (house mouse) mmu-miR-495-3p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-495-3p
  13. Ovis aries oar-miR-495-3p
  14. Pan troglodytes (chimpanzee) ptr-miR-495
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-495
  16. Pteropus alecto (black flying fox) pal-miR-495-3p
  17. Sus scrofa ssc-mir35
Publications