Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-495 URS000005A8ED_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACAAACAUGGUGCACUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-495
  2. Callithrix jacchus cja-miR-495
  3. Canis lupus familiaris (dog) cfa-miR-495
  4. Capra hircus (goat) chi-miR-495-3p
  5. Cavia porcellus cpo-miR-495-3p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-495-3p
  7. Echinops telfairi Ete-Mir-154-P19_3p (mature (guide))
  8. Homo sapiens hsa-miR-495-3p
  9. Macaca mulatta (Rhesus monkey) mml-miR-495-3p
  10. Mus musculus (house mouse) mmu-miR-495-3p
  11. Oryctolagus cuniculus (rabbit) ocu-miR-495-3p
  12. Ovis aries oar-miR-495-3p
  13. Pan troglodytes (chimpanzee) ptr-miR-495
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-495
  15. Pteropus alecto (black flying fox) pal-miR-495-3p
  16. Rattus norvegicus rno-miR-495
  17. Sus scrofa ssc-mir35
Publications