Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-495-3p URS000005A8ED_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACAAACAUGGUGCACUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-495
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-495
  3. Canis lupus familiaris cfa-miR-495
  4. Capra hircus (goat) chi-miR-495-3p
  5. Cavia porcellus cpo-miR-495-3p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-495-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P19_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-495
  9. Homo sapiens (human) hsa-miR-495-3p
  10. Macaca mulatta mml-miR-495-3p
  11. Mus musculus mmu-miR-495-3p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-495-3p
  13. Pan troglodytes (chimpanzee) ptr-miR-495
  14. Pongo pygmaeus ppy-miR-495
  15. Pteropus alecto pal-miR-495-3p
  16. Rattus norvegicus (Norway rat) rno-miR-495
  17. Sus scrofa ssc-mir35
Publications