Pteropus alecto (black flying fox) pal-miR-495-3p

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus alecto (black flying fox) pal-miR-495-3p URS000005A8ED_9402

22 nucleotides
1 database (miRBase)
Found in 17 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AAACAAACAUGGUGCACUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Bos taurus bta-miR-495
Callithrix jacchus cja-miR-495
Canis lupus familiaris (dog) cfa-miR-495
Capra hircus (goat) chi-miR-495-3p
Cavia porcellus cpo-miR-495-3p
Dasypus novemcinctus (nine-banded armadillo) dno-miR-495-3p
Echinops telfairi Ete-Mir-154-P19_3p (mature (guide))
Equus caballus (horse) eca-miR-495
Homo sapiens hsa-miR-495-3p
Macaca mulatta (Rhesus monkey) mml-miR-495-3p
Mus musculus (house mouse) mmu-miR-495-3p
Oryctolagus cuniculus (rabbit) ocu-miR-495-3p
Ovis aries oar-miR-495-3p
Pan troglodytes (chimpanzee) ptr-miR-495
Pongo pygmaeus (Bornean orangutan) ppy-miR-495
Rattus norvegicus rno-miR-495
Sus scrofa ssc-mir35