v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-mir35 URS000005A8ED_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAACAAACAUGGUGCACUUCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus bta-miR-495
  2. Callithrix jacchus cja-miR-495
  3. Canis lupus familiaris (dog) cfa-miR-495
  4. Capra hircus (goat) chi-miR-495-3p
  5. Cavia porcellus cpo-miR-495-3p
  6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-495-3p
  7. Echinops telfairi Ete-Mir-154-P19_3p (mature (guide))
  8. Equus caballus (horse) eca-miR-495
  9. Homo sapiens hsa-miR-495-3p
  10. Macaca mulatta (Rhesus monkey) mml-miR-495-3p
  11. Mus musculus (house mouse) mmu-miR-495-3p
  12. Oryctolagus cuniculus (rabbit) ocu-miR-495-3p
  13. Ovis aries oar-miR-495-3p
  14. Pan troglodytes (chimpanzee) ptr-miR-495
  15. Pongo pygmaeus (Bornean orangutan) ppy-miR-495
  16. Pteropus alecto (black flying fox) pal-miR-495-3p
  17. Rattus norvegicus rno-miR-495