Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Asparagus officinalis (garden asparagus) aof-miR160a URS00006096FF_4686

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCUCCCUGAAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Ananas comosus microRNA 160f
  2. Arachis hypogaea ahy-miR160-5p
  3. Brachypodium distachyon (stiff brome) bdi-miR160e-5p
  4. Carica papaya (papaya) cpa-miR160d
  5. Corchorus capsularis sRNA CCACVL1_29978
  6. Cucumis melo cme-miR160d
  7. Manihot esculenta mes-miR160f
  8. Medicago truncatula mtr-miR160c
  9. Oryza sativa (Asian cultivated rice) osa-miR160f-5p
  10. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160f-5p
  11. Populus tomentosa Pto-miR160f
  12. Populus trichocarpa (black cottonwood) ptc-miR160f
  13. Ricinus communis rco-miR160c
  14. Sorghum bicolor (sorghum) sbi-miR160f
  15. Theobroma cacao tcc-miR160a
  16. Vriesea carinata vca-miR160-5p
Publications