Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Theobroma cacao (cacao) tcc-miR160a URS00006096FF_3641

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCUCCCUGAAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Ananas comosus microRNA 160f
  2. Arachis hypogaea ahy-miR160-5p
  3. Asparagus officinalis (garden asparagus) aof-miR160a
  4. Brachypodium distachyon (stiff brome) bdi-miR160e-5p
  5. Carica papaya (papaya) cpa-miR160d
  6. Corchorus capsularis sRNA CCACVL1_29978
  7. Cucumis melo cme-miR160d
  8. Manihot esculenta mes-miR160f
  9. Medicago truncatula mtr-miR160c
  10. Oryza sativa (Asian cultivated rice) osa-miR160f-5p
  11. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160f-5p
  12. Populus tomentosa Pto-miR160f
  13. Populus trichocarpa (black cottonwood) ptc-miR160f
  14. Ricinus communis rco-miR160c
  15. Sorghum bicolor (sorghum) sbi-miR160f
  16. Vriesea carinata vca-miR160-5p