Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa (Asian cultivated rice) osa-miR160f-5p URS00006096FF_4530

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

osa-miR160f-5p: Osa-mir160f-5p is a microRNA that is significantly down-regulated in DBA Aurora under all stresses, but up-regulated in L6 under heat stress (HS) and waterlogging stress (WH) [PMC7504575]. It has been found to target the chloroplastic PGR5-like protein, which is significantly up-regulated under HS and WH in both genotypes, with a higher fold-change in DBA Aurora under WH [PMC7504575]. The reduced abundance of osa-mir160f-5p and ata-miR396c-5p leads to increased expression of NDH and PGR5 in durum wheat [PMC9459240]. Osa-mir160f-5p is part of the osa-miR160 family, which targets seven members of the ARF gene family, including ARF4, ARF6, ARF8, ARF10, ARF16, ARF17 and ARF18 [PMC4257594]. In addition to osa-mir160f-5p, other members of the osa-miR160 family such as osa-miR167a-5p_R-1 and osa-miR167b_R-1 also target ARF6 and ARF8 [PMC4257594]. The expression levels of osa-miR167a-5p_R-1, osa-miR167b_R-1, osa-miR167c-5p_R-1, osa-miR160d-5p, osa-miR160e-5p and osa-mir160f were significantly higher in N2Y6 compared to LYP9 during grain-filling stages [PMC4257594]. This higher expression leads to decreased expression of ARF6 and ARF8, potentially repressing the production of jasmonic acid (JA) [PMC4257594]. Overall, osa-mir160f-5p plays a role in regulating the expression of target genes involved in stress response and hormone signaling pathways in durum wheat.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCUCCCUGAAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Ananas comosus microRNA 160f
  2. Arachis hypogaea ahy-miR160-5p
  3. Asparagus officinalis (garden asparagus) aof-miR160a
  4. Brachypodium distachyon (stiff brome) bdi-miR160e-5p
  5. Carica papaya (papaya) cpa-miR160d
  6. Corchorus capsularis sRNA CCACVL1_29978
  7. Cucumis melo cme-miR160d
  8. Manihot esculenta mes-miR160f
  9. Medicago truncatula mtr-miR160c
  10. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160f-5p
  11. Populus tomentosa Pto-miR160f
  12. Populus trichocarpa (black cottonwood) ptc-miR160f
  13. Ricinus communis rco-miR160c
  14. Sorghum bicolor (sorghum) sbi-miR160f
  15. Theobroma cacao tcc-miR160a
  16. Vriesea carinata vca-miR160-5p
Publications