Corchorus capsularis (jute) sRNA CCACVL1_29978 URS00006096FF_210143

• 21 nucleotides
• 2 databases (ENA, Ensembl Plants)
• Found in 16 other species
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGCCUGGCUCCCUGAAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

1. Ananas comosus microRNA 160f
2. Arachis hypogaea ahy-miR160-5p
3. Asparagus officinalis (garden asparagus) aof-miR160a
4. Brachypodium distachyon (stiff brome) bdi-miR160e-5p
5. Carica papaya (papaya) cpa-miR160d
6. Cucumis melo cme-miR160d
7. Manihot esculenta mes-miR160f
8. Medicago truncatula mtr-miR160c
9. Oryza sativa (Asian cultivated rice) osa-miR160f-5p
10. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160f-5p
11. Populus tomentosa Pto-miR160f
12. Populus trichocarpa (black cottonwood) ptc-miR160f
13. Ricinus communis rco-miR160c
14. Sorghum bicolor (sorghum) sbi-miR160f
15. Theobroma cacao tcc-miR160a
16. Vriesea carinata vca-miR160-5p

Download

• FASTA
• JSON