Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Arachis hypogaea (peanut) ahy-miR160-5p URS00006096FF_3818

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ahy-miR160-5p: Ahy-mir160-5p is a microRNA that is down-regulated and accumulates in response to P deficiency stress. It targets four ARF genes, namely ARF16, ARF17, ARF18.1, and ARF18.2 [PMC9661748]. Under P deficiency stress, the transcription of ahy-mir160-5p and its target genes is altered, with the expression of ahy-mir160-5p being up-regulated and the target genes being down-regulated [PMC9661748]. This suggests that ahy-mir160-5p plays a role in regulating the peanut auxin signal transduction pathway in response to P deficiency stress [PMC9661748]. Additionally, it was found that the expression of ahy-mir160-5p was significantly up-regulated while its target genes were significantly down-regulated under -P treatment [PMC9661748]. The up-regulation of ahy-mir160-5p in response to P deficiency stress was observed in this study [PMC9661748]. Furthermore, it was discovered that the promoter region of ahy-mir160-5p contains an L3 element that can be bound by Dof11 transcription factors [PMC9661748]. In this study, other miRNAs were also found to be differentially expressed under -P treatment, with two miRNAs being up-regulated (ahy-miR3518 and ahy-mir160-5p) and four miRNAs being down-regulated (ahy-miR408-5p, ahy-miR408-3p, ahy-miR398, and ahy-miR3515) [PMC9661748].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGGCUCCCUGAAUGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Ananas comosus microRNA 160f
  2. Asparagus officinalis (garden asparagus) aof-miR160a
  3. Brachypodium distachyon (stiff brome) bdi-miR160e-5p
  4. Carica papaya (papaya) cpa-miR160d
  5. Corchorus capsularis sRNA CCACVL1_29978
  6. Cucumis melo cme-miR160d
  7. Manihot esculenta mes-miR160f
  8. Medicago truncatula mtr-miR160c
  9. Oryza sativa (Asian cultivated rice) osa-miR160f-5p
  10. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR160f-5p
  11. Populus tomentosa Pto-miR160f
  12. Populus trichocarpa (black cottonwood) ptc-miR160f
  13. Ricinus communis rco-miR160c
  14. Sorghum bicolor (sorghum) sbi-miR160f
  15. Theobroma cacao tcc-miR160a
  16. Vriesea carinata vca-miR160-5p
Publications