v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Nylanderia fulva tRNA secondary structure diagram

Nylanderia fulva tRNA URS000051488D_613905

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GACCGUGUGGCCUAAUGGAUAAGGCGUCGGACUUCGGAUCCGAAGAUUGCAGGUUCGAGUCCUGUCACGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 275 other species

  1. Acanthoscelides obtectus tRNA
  2. Acromyrmex charruanus tRNA
  3. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Arg
  4. Acromyrmex heyeri tRNA
  5. Acyrthosiphon pisum (Pea aphid) tRNA-Arg
  6. Adelges cooleyi (Spruce gall adelgid) transfer RNA arginine (anticodon UCG)
  7. Aedes aegypti (Yellow fever mosquito) tRNA AAEL016068
  8. Aegilops tauschii subsp. strangulata tRNA-Arg for anticodon UCG
  9. Aethina tumida (Small hive beetle) transfer RNA arginine (anticodon UCG)
  10. Agrilus planipennis tRNA-Arg
  11. Allacma fusca tRNA
  12. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011450.1
  13. Amyelois transitella (Naval orange worm) tRNA-Arg
  14. Anastrepha ludens (Mexican fruit fly) transfer RNA arginine (anticodon UCG)
  15. Anastrepha obliqua (WestIndian fruit fly) transfer RNA arginine (anticodon UCG)
  16. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000012001.1
  17. Anthonomus grandis grandis (Boll weevil) transfer RNA arginine (anticodon UCG)
  18. Aphis craccivora (cowpea aphid) tRNA
  19. Aphis glycines (soybean aphid) tRNA
  20. Aphis gossypii (cotton aphid) tRNA
  21. Apis cerana cerana tRNA
  22. Apis dorsata tRNA-Arg
  23. Apis florea (Dwarf honeybee) tRNA-Arg
  24. Apis mellifera tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  25. Apolygus lucorum tRNA
  26. Arabis alpina (gray rockcress) tRNA
  27. Armadillidium nasatum tRNA
  28. Aromia moschata tRNA-OTHER
  29. Asbolus verrucosus (desert ironclad beetle) tRNA
  30. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005004798.1
  31. Atta cephalotes tRNA LOC105616968-3
  32. Atta colombica tRNA
  33. Bactrocera dorsalis tRNA-Arg
  34. Bactrocera latifrons tRNA-Arg
  35. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA arginine (anticodon UCG)
  36. Bactrocera tryoni tRNA-Arg
  37. Bemisia tabaci tRNA
  38. Bicyclus anynana (Squinting bush brown) tRNA-Arg
  39. Blattella germanica tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  40. Bombus affinis (Rusty patched bumble bee) transfer RNA arginine (anticodon UCG)
  41. Bombus huntii (Hunt's bumblebee) transfer RNA arginine (anticodon UCG)
  42. Bombus terrestris tRNA LOC110119195
  43. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Arg
  44. Bombus vosnesenskii tRNA
  45. Bombyx mandarina (Wild silkworm) tRNA-Arg
  46. Bombyx mori tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 7)
  47. Brenthis ino (lesser marbled fritillary) tRNA
  48. Callosobruchus analis hypothetical protein
  49. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  50. Callosobruchus maculatus (cowpea weevil) tRNA
  51. Camponotus floridanus (Florida carpenter ant) tRNA-Arg
  52. Cataglyphis hispanica (Desert ant) transfer RNA arginine (anticodon UCG)
  53. Cephus cinctus (wheat stem sawfly) tRNA
  54. Ceratitis capitata tRNA-Arg
  55. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  56. Chelonus insularis (Parasitoid wasp) tRNA-Arg
  57. Cherax quadricarinatus (Australian red claw crayfish) transfer RNA arginine (anticodon UCG)
  58. Chionoecetes opilio (snow crab) tRNA
  59. Chrysodeixis includens tRNA
  60. Cimex lectularius (Bed bug) tRNA-Arg
  61. Cinara cedri tRNA
  62. Cloeon dipterum tRNA
  63. Copidosoma floridanum (Parasitoid wasp) tRNA-Arg
  64. Coptotermes formosanus (Formosan subterranean termite) tRNA
  65. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015228.1
  66. Cotesia congregata tRNA
  67. Cotesia glomerata tRNA-Arg
  68. Cotesia typhae tRNA
  69. Cryptolaemus montrouzieri tRNA-Arg
  70. Cryptotermes secundus tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  71. Ctenocephalides felis (Cat flea) tRNA-Arg
  72. Cucumis melo var. makuwa tRNA
  73. Culex pipiens pallens (Northern house mosquito) transfer RNA arginine (anticodon UCG)
  74. Culex quinquefasciatus tRNA-Arg
  75. Cylas formicarius (Sweet potato weevil) transfer RNA arginine (anticodon UCG)
  76. Cyphomyrmex costatus tRNA
  77. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA arginine (anticodon UCG)
  78. Danaus chrysippus (African queen) tRNA
  79. Danaus plexippus plexippus tRNA
  80. Dendroctonus ponderosae (Mountain pine beetle) tRNA-Arg
  81. Diabrotica balteata tRNA
  82. Diabrotica virgifera virgifera transfer RNA arginine (anticodon UCG)
  83. Diachasma alloeum tRNA
  84. Diaphorina citri (Asian citrus psyllid) tRNA-Arg
  85. Diatraea saccharalis (sugarcane borer) tRNA
  86. Dinoponera quadriceps (south american ant) tRNA
  87. Diorhabda carinulata (Northern tamarisk beetle) transfer RNA arginine (anticodon UCG)
  88. Diorhabda sublineata (Subtropical tamarisk beetle) transfer RNA arginine (anticodon UCG)
  89. Diuraphis noxia tRNA-Arg
  90. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  91. Drosophila albomicans (Fruit fly) transfer RNA arginine (anticodon UCG)
  92. Drosophila ananassae tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 5)
  93. Drosophila arizonae (Fruit fly) tRNA-Arg
  94. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon UCG)
  95. Drosophila bipectinata (Fruit fly) tRNA-Arg
  96. Drosophila busckii (Fruit fly) tRNA-Arg
  97. Drosophila elegans (Fruit fly) tRNA-Arg
  98. Drosophila erecta tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  99. Drosophila eugracilis (Fruit fly) tRNA-Arg
  100. Drosophila ficusphila (Fruit fly) tRNA-Arg
  101. Drosophila grimshawi tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  102. Drosophila guanche (Fruit fly) tRNA-Arg
  103. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon UCG)
  104. Drosophila hydei (Fruit fly) tRNA-Arg
  105. Drosophila innubila (Fruit fly) tRNA-Arg
  106. Drosophila kikkawai (Fruit fly) tRNA-Arg
  107. Drosophila mauritiana (Fruit fly) tRNA-Arg
  108. Drosophila melanogaster transfer RNA:Arginine-TCG 2-3 (Dmel_CR31443, Dmel_CR32526, Dmel_CR32624, Dmel_CR33551)
  109. Drosophila miranda (Fruit fly) tRNA-Arg
  110. Drosophila mojavensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  111. Drosophila navojoa (Fruit fly) tRNA-Arg
  112. Drosophila obscura (Fruit fly) tRNA-Arg
  113. Drosophila persimilis tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  114. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  115. Drosophila pseudoobscura pseudoobscura tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  116. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  117. Drosophila santomea (Fruit fly) tRNA-Arg
  118. Drosophila sechellia tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  119. Drosophila simulans tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
  120. Drosophila subobscura (Fruit fly) tRNA-Arg
  121. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  122. Drosophila suzukii (Fruit fly) tRNA-Arg
  123. Drosophila takahashii (Fruit fly) tRNA-Arg
  124. Drosophila teissieri (Fruit fly) tRNA-Arg
  125. Drosophila virilis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  126. Drosophila willistoni tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  127. Drosophila yakuba tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  128. Dryococelus australis tRNA-OTHER
  129. Dufourea novaeangliae (Bee) tRNA-Arg
  130. Eriocheir sinensis (Chinese mitten crab) transfer RNA arginine (anticodon UCG)
  131. Eufriesea mexicana tRNA-Arg
  132. Eumeta japonica tRNA
  133. Exocentrus adspersus tRNA-OTHER
  134. Fopius arisanus tRNA
  135. Frankliniella occidentalis (western flower thrips) tRNA
  136. Frieseomelitta varia tRNA
  137. Galleria mellonella tRNA-Arg
  138. Glossina austeni tRNA tRNA-Arg
  139. Glossina brevipalpis tRNA tRNA-Arg
  140. Glossina fuscipes fuscipes tRNA
  141. Glossina morsitans morsitans tRNA tRNA-Arg
  142. Glossina pallidipes (Tsetse fly) tRNA tRNA-Arg
  143. Glossina palpalis gambiensis tRNA tRNA-Arg
  144. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014592.1
  145. Gossypium arboreum tRNA
  146. Habropoda laboriosa tRNA-Arg
  147. Halocaridina rubra tRNA-Arg
  148. Halyomorpha halys (Brown marmorated stink bug) tRNA-Arg
  149. Harpegnathos saltator tRNA-Arg
  150. Heliconius melpomene tRNA HMEL013664
  151. Helicoverpa armigera (Cotton bollworm) transfer RNA arginine (anticodon UCG)
  152. Helicoverpa zea (Corn earworm) tRNA-Arg
  153. Heliothis virescens (tobacco budworm) tRNA
  154. Henosepilachna vigintioctopunctata tRNA-Arg
  155. Hermetia illucens (Black soldier fly) tRNA-Arg
  156. Heterotrigona itama tRNA
  157. Homalodisca vitripennis tRNA-Arg
  158. Homarus americanus (American lobster) tRNA-Arg
  159. Homarus gammarus (European lobster) misc RNA ENSHGAG00000025494.1
  160. Hordeum vulgare subsp. vulgare (domesticated barley) tRNA
  161. Hyalella azteca (Amphipod) tRNA-Arg
  162. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA arginine (anticodon UCG)
  163. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA arginine (anticodon UCG)
  164. Hypothenemus hampei tRNA-Arg
  165. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005011511.1
  166. Ignelater luminosus (cucubano) tRNA
  167. Ladona fulva tRNA
  168. Laodelphax striatellus (small brown planthopper) tRNA
  169. Lasius niger tRNA
  170. Leguminivora glycinivorella tRNA-Arg
  171. Leptidea sinapis tRNA
  172. Leptinotarsa decemlineata tRNA-Arg
  173. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015149.1
  174. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015699.1
  175. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015898.1
  176. Lucilia cuprina (Australian sheep blowfly) tRNA-Arg for anticodon UCG
  177. Lupinus angustifolius tRNA
  178. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011427.1
  179. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA arginine (anticodon UCG)
  180. Manduca sexta (Tobacco hornworm) tRNA-Arg
  181. Megachile rotundata tRNA-Arg
  182. Megaselia scalaris tRNA-Arg for anticodon UCG
  183. Melanaphis sacchari (Sugarcane aphid) tRNA-Arg
  184. Melipona bicolor tRNA
  185. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023674.1
  186. Mesorhabditis belari tRNA
  187. Mesorhabditis spiculigera tRNA
  188. Microctonus aethiopoides tRNA
  189. Microctonus hyperodae tRNA
  190. Microplitis demolitor (Parasitoid wasp) transfer RNA arginine (anticodon UCG)
  191. Microplitis mediator (Endoparasitoid wasp) transfer RNA arginine (anticodon UCG)
  192. Molorchus minor tRNA-Arg
  193. Monomorium pharaonis tRNA-Arg
  194. Musca domestica tRNA MDOA013775
  195. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013038.1
  196. Nasonia vitripennis tRNA-Arg
  197. Neodiprion lecontei tRNA-Arg
  198. Neodiprion pinetum (White pine sawfly) tRNA-Arg
  199. Nesidiocoris tenuis tRNA
  200. Nezara viridula (southern green stink bug) tRNA
  201. Nilaparvata lugens tRNA-Arg
  202. Onthophagus taurus tRNA-Arg
  203. Ooceraea biroi (Clonal raider ant) tRNA-Arg
  204. Operophtera brumata (winter moth) tRNA
  205. Orussus abietinus (Parasitic wood wasp) tRNA-Arg
  206. Oryctes borbonicus tRNA
  207. Papaver nudicaule tRNA
  208. Papaver somniferum (opium poppy) tRNA
  209. Papilio machaon tRNA
  210. Papilio xuthus tRNA
  211. Pararge aegeria aegeria tRNA
  212. Pararge aegeria tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 8)
  213. Arctia plantaginis Parasemia plantaginis tRNA
  214. Parnassius apollo (apollo) tRNA
  215. Pectinophora gossypiella (Pink bollworm) transfer RNA arginine (anticodon UCG)
  216. Pediculus humanus corporis tRNA tRNA-Arg
  217. Penaeus chinensis tRNA-Arg
  218. Penaeus japonicus (Kuruma shrimp) tRNA-Arg
  219. Penaeus monodon (Black tiger shrimp) tRNA-Arg
  220. Penaeus vannamei (Pacific white shrimp) tRNA-Arg
  221. Phaedon cochleariae (mustard beetle) tRNA
  222. Photinus pyralis (common eastern firefly) tRNA
  223. Phyllotreta striolata tRNA
  224. Pieris brassicae (large cabbage white) tRNA
  225. Pieris macdunnoughi tRNA
  226. Plodia interpunctella (Indianmeal moth) transfer RNA arginine (anticodon UCG)
  227. Plutella xylostella tRNA
  228. Pogonomyrmex barbatus (Red harvester ant) tRNA-Arg
  229. Polistes canadensis tRNA-Arg
  230. Polistes dominula tRNA-Arg
  231. Polistes fuscatus tRNA-Arg
  232. Polyplax serrata tRNA-Arg
  233. Portunus trituberculatus (Swimming crab) tRNA-Arg
  234. Procambarus clarkii (Red swamp crayfish) tRNA-Arg
  235. Pseudoatta argentina tRNA
  236. Psylliodes chrysocephalus Psylliodes chrysocephala tRNA
  237. Punica granatum tRNA
  238. Rhagoletis pomonella tRNA-Arg
  239. Rhamnusium bicolor tRNA-Arg
  240. Rhodnius prolixus tRNA tRNA-Arg
  241. Rhopalosiphum maidis tRNA-Arg
  242. Rhynchophorus ferrugineus (red palm weevil) tRNA
  243. Scaptodrosophila lebanonensis tRNA
  244. Schistocerca americana (American grasshopper) tRNA-Arg
  245. Schistocerca cancellata (South American locust) transfer RNA arginine (anticodon UCG)
  246. Schistocerca gregaria (Grasshoppers) transfer RNA arginine (anticodon UCG)
  247. Schistocerca nitens (Vagrant locust) transfer RNA arginine (anticodon UCG)
  248. Schistocerca piceifrons (Central American locust) tRNA-Arg
  249. Schistocerca serialis cubense (Grasshoppers) transfer RNA arginine (anticodon UCG)
  250. Sipha flava tRNA-Arg
  251. Sitophilus oryzae tRNA-Arg
  252. Solenopsis invicta (red fire ant) tRNA
  253. Spodoptera exigua (beet armyworm) tRNA
  254. Spodoptera frugiperda tRNA-Arg (TCG) (tRNA-Arg-TCG-3 1 to 7)
  255. Spodoptera littoralis tRNA
  256. Spodoptera litura tRNA
  257. Steinernema carpocapsae tRNA
  258. Steinernema glaseri tRNA
  259. Steinernema hermaphroditum tRNA
  260. Stomoxys calcitrans (Stable fly) tRNA-Arg
  261. Temnothorax curvispinosus tRNA
  262. Temnothorax longispinosus tRNA
  263. Tenebrio molitor (yellow mealworm) tRNA
  264. Thrips palmi tRNA-Arg
  265. Trachymyrmex cornetzi tRNA
  266. Trachymyrmex septentrionalis tRNA
  267. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  268. Trialeurodes vaporariorum tRNA-Arg for anticodon UCG
  269. Tribolium castaneum tRNA-Arg for anticodon UCG
  270. Tribolium madens (Black flour beetle) tRNA-Arg
  271. Trichogramma brassicae tRNA
  272. Trichogramma pretiosum (Parasitoid wasp) tRNA-Arg
  273. Trichomalopsis sarcophagae tRNA
  274. Trichoplusia ni (cabbage looper) tRNA
  275. Vanessa tameamea tRNA
  276. Venturia canescens tRNA-Arg
  277. Vespula germanica tRNA
  278. Vespula pensylvanica (western yellowjacket) tRNA
  279. Vespula vulgaris tRNA
  280. Zerene cesonia tRNA-Arg
  281. Zeugodacus cucurbitae (Melon fly) transfer RNA arginine (anticodon UCG)
  282. Zootermopsis nevadensis tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...