Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Aromia moschata tRNA-OTHER secondary structure diagram

Aromia moschata tRNA-OTHER URS000051488D_1265417

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCGUGUGGCCUAAUGGAUAAGGCGUCGGACUUCGGAUCCGAAGAUUGCAGGUUCGAGUCCUGUCACGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 298 other species

  1. Acanthoscelides obtectus tRNA
  2. Acromyrmex charruanus tRNA
  3. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Arg
  4. Acromyrmex heyeri tRNA
  5. Acyrthosiphon pisum (Pea aphid) tRNA-Arg
  6. Adelges cooleyi (Spruce gall adelgid) transfer RNA arginine (anticodon UCG)
  7. Aedes aegypti tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  8. Aegilops tauschii subsp. strangulata tRNA-Arg for anticodon UCG
  9. Aethina tumida (Small hive beetle) transfer RNA arginine (anticodon UCG)
  10. Agrilus planipennis tRNA-Arg
  11. Allacma fusca tRNA
  12. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011450.1
  13. Amyelois transitella (Moths) transfer RNA arginine (anticodon UCG)
  14. Anastrepha ludens (Mexican fruit fly) transfer RNA arginine (anticodon UCG)
  15. Anastrepha obliqua (WestIndian fruit fly) transfer RNA arginine (anticodon UCG)
  16. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000012001.1
  17. Anoplophora glabripennis (Asian long-horned beetle) tRNA-Arg
  18. Anthonomus grandis grandis transfer RNA arginine (anticodon UCG)
  19. Aphis craccivora (cowpea aphid) tRNA
  20. Aphis glycines (soybean aphid) tRNA
  21. Aphis gossypii (cotton aphid) tRNA
  22. Apis cerana cerana tRNA
  23. Apis dorsata (Giant honeybee) tRNA-Arg
  24. Apis florea tRNA-Arg
  25. Apis mellifera tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  26. Apolygus lucorum tRNA
  27. Arabis alpina (gray rockcress) tRNA
  28. Armadillidium nasatum tRNA
  29. Armadillidium vulgare tRNA-Arg
  30. Asbolus verrucosus (desert ironclad beetle) tRNA
  31. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005004798.1
  32. Atta cephalotes tRNA LOC105616968-3
  33. Atta colombica tRNA
  34. Bactrocera dorsalis (Oriental fruit fly) transfer RNA arginine (anticodon UCG)
  35. Bactrocera latifrons tRNA-Arg
  36. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA arginine (anticodon UCG)
  37. Bactrocera oleae (Olive fruit fly) tRNA-Arg
  38. Bactrocera tryoni (Queensland fruitfly) tRNA-Arg
  39. Bemisia tabaci tRNA
  40. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026295.1
  41. Blattella germanica tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  42. Bombus affinis (Rusty patched bumble bee) transfer RNA arginine (anticodon UCG)
  43. Bombus huntii (Hunt's bumblebee) transfer RNA arginine (anticodon UCG)
  44. Bombus impatiens (Common eastern bumblebee) tRNA-Arg
  45. Bombus terrestris (Bombus terrestris) misc RNA ENSBTSG00005027074.1
  46. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Arg
  47. Bombus vosnesenskii tRNA
  48. Bombyx mandarina (Wild silkworm) tRNA-Arg
  49. Bombyx mori tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 7)
  50. Brenthis ino (lesser marbled fritillary) tRNA
  51. Callosobruchus analis hypothetical protein
  52. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  53. Callosobruchus maculatus (cowpea weevil) tRNA
  54. Camponotus floridanus tRNA-Arg
  55. Cataglyphis hispanica (Desert ant) transfer RNA arginine (anticodon UCG)
  56. Cephus cinctus (wheat stem sawfly) tRNA
  57. Ceratitis capitata tRNA-Arg
  58. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  59. Chelonus insularis tRNA-Arg
  60. Cherax quadricarinatus (Australian red claw crayfish) transfer RNA arginine (anticodon UCG)
  61. Chionoecetes opilio (snow crab) tRNA
  62. Chrysodeixis includens tRNA
  63. Chrysoperla carnea (Green lacewing) tRNA-Arg
  64. Cimex lectularius tRNA-Arg
  65. Cinara cedri tRNA
  66. Cloeon dipterum tRNA
  67. Copidosoma floridanum tRNA-Arg
  68. Coptotermes formosanus (Formosan subterranean termite) tRNA
  69. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015228.1
  70. Cotesia congregata tRNA
  71. Cotesia glomerata tRNA-Arg
  72. Cotesia typhae tRNA
  73. Cryptolaemus montrouzieri tRNA-Arg
  74. Cryptotermes secundus tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  75. Ctenocephalides felis (Cat flea) tRNA-Arg
  76. Cucumis melo var. makuwa tRNA
  77. Culex pipiens pallens (Northern house mosquito) transfer RNA arginine (anticodon UCG)
  78. Culex quinquefasciatus (southern house mosquito) tRNA
  79. Cydia pomonella (The codling moth) transfer RNA arginine (anticodon UCG)
  80. Cylas formicarius (Sweet potato weevil) transfer RNA arginine (anticodon UCG)
  81. Cyphomyrmex costatus tRNA
  82. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA arginine (anticodon UCG)
  83. Danaus chrysippus (African queen) tRNA
  84. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018449.1
  85. Danaus plexippus plexippus (Monarch butterfly) tRNA-Arg
  86. Dendroctonus ponderosae tRNA-Arg
  87. Diabrotica balteata tRNA
  88. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA arginine (anticodon UCG)
  89. Diachasma alloeum tRNA
  90. Diaphorina citri (Asian citrus psyllid) tRNA-Arg
  91. Diatraea saccharalis (sugarcane borer) tRNA
  92. Dinoponera quadriceps (south american ant) tRNA
  93. Diorhabda carinulata (Northern tamarisk beetle) transfer RNA arginine (anticodon UCG)
  94. Diorhabda sublineata (Subtropical tamarisk beetle) transfer RNA arginine (anticodon UCG)
  95. Diuraphis noxia tRNA-Arg
  96. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  97. Drosophila albomicans (Fruit fly) transfer RNA arginine (anticodon UCG)
  98. Drosophila ananassae tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 5)
  99. Drosophila arizonae (Fruit fly) tRNA-Arg
  100. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon UCG)
  101. Drosophila bipectinata (Pomace flies) transfer RNA arginine (anticodon UCG)
  102. Drosophila busckii (Fruit fly) tRNA-Arg
  103. Drosophila elegans (Pomace flies) tRNA-Arg
  104. Drosophila erecta tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  105. Drosophila eugracilis (Fruit fly) tRNA-Arg
  106. Drosophila ficusphila (Fruit fly) tRNA-Arg
  107. Drosophila grimshawi tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  108. Drosophila guanche (Fruit fly) tRNA-Arg
  109. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon UCG)
  110. Drosophila hydei (Fruit fly) tRNA-Arg
  111. Drosophila innubila (Fruit fly) tRNA-Arg
  112. Drosophila kikkawai (Pomace flies) transfer RNA arginine (anticodon UCG)
  113. Drosophila mauritiana (Fruit fly) tRNA-Arg
  114. Drosophila melanogaster (fruit fly) transfer RNA:Arginine-TCG 2-3 (Dmel_CR31443, Dmel_CR32526, Dmel_CR32624, Dmel_CR33551)
  115. Drosophila miranda (Fruit fly) tRNA-Arg
  116. Drosophila mojavensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  117. Drosophila montana (Pomace flies) transfer RNA arginine (anticodon UCG)
  118. Drosophila nasuta (Pomace flies) transfer RNA arginine (anticodon UCG)
  119. Drosophila navojoa (Fruit fly) tRNA-Arg
  120. Drosophila novamexicana (Pomace flies) tRNA-Arg
  121. Drosophila obscura (Fruit fly) tRNA-Arg
  122. Drosophila persimilis tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  123. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  124. Drosophila pseudoobscura pseudoobscura tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  125. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  126. Drosophila santomea (Fruit fly) tRNA-Arg
  127. Drosophila sechellia tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  128. Drosophila serrata (Pomace flies) tRNA-Arg
  129. Drosophila simulans tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
  130. Drosophila subobscura (Fruit fly) tRNA-Arg
  131. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  132. Drosophila sulfurigaster albostrigata (Flies) transfer RNA arginine (anticodon UCG)
  133. Drosophila suzukii (Pomace flies) transfer RNA arginine (anticodon UCG)
  134. Drosophila takahashii (Pomace flies) transfer RNA arginine (anticodon UCG)
  135. Drosophila teissieri (Fruit fly) tRNA-Arg
  136. Drosophila tropicalis (Pomace flies) transfer RNA arginine (anticodon UCG)
  137. Drosophila virilis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  138. Drosophila willistoni tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  139. Drosophila yakuba tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  140. Dryococelus australis tRNA-OTHER
  141. Dufourea novaeangliae tRNA-Arg
  142. Eriocheir sinensis (Chinese mitten crab) transfer RNA arginine (anticodon UCG)
  143. Eufriesea mexicana (Bee) tRNA-Arg
  144. Eumeta japonica tRNA
  145. Exocentrus adspersus tRNA-OTHER
  146. Fopius arisanus tRNA
  147. Frankliniella occidentalis (western flower thrips) tRNA
  148. Frieseomelitta varia tRNA
  149. Galleria mellonella (greater wax moth) tRNA
  150. Glossina austeni tRNA tRNA-Arg
  151. Glossina brevipalpis tRNA tRNA-Arg
  152. Glossina fuscipes fuscipes tRNA
  153. Glossina fuscipes (Tsetse fly) tRNA-Arg
  154. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Arg
  155. Glossina pallidipes tRNA tRNA-Arg
  156. Glossina palpalis gambiensis tRNA tRNA-Arg
  157. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014592.1
  158. Gossypium arboreum tRNA
  159. Habropoda laboriosa tRNA-Arg
  160. Halocaridina rubra tRNA-Arg
  161. Halyomorpha halys (Brown marmorated stink bug) tRNA-Arg
  162. Harpegnathos saltator tRNA-Arg
  163. Heliconius melpomene (Postman butterfly) tRNA HMEL013664
  164. Helicoverpa armigera transfer RNA arginine (anticodon UCG)
  165. Helicoverpa zea tRNA-Arg
  166. Heliothis virescens (tobacco budworm) tRNA
  167. Henosepilachna vigintioctopunctata tRNA-Arg
  168. Hermetia illucens tRNA-Arg
  169. Heterotrigona itama tRNA
  170. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Arg
  171. Homarus americanus tRNA-Arg
  172. Homarus gammarus (European lobster) misc RNA ENSHGAG00000025494.1
  173. Hordeum vulgare subsp. vulgare (domesticated barley) tRNA
  174. Hyalella azteca (Amphipod) tRNA-Arg
  175. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA arginine (anticodon UCG)
  176. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA arginine (anticodon UCG)
  177. Hypothenemus hampei tRNA-Arg
  178. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005011511.1
  179. Ignelater luminosus (cucubano) tRNA
  180. Ischnura elegans (Damselflies) tRNA-Arg
  181. Ladona fulva tRNA
  182. Laodelphax striatellus (small brown planthopper) tRNA
  183. Lasius niger tRNA
  184. Leguminivora glycinivorella (Soybean pod borer) tRNA-Arg
  185. Leptidea sinapis tRNA
  186. Leptinotarsa decemlineata tRNA-Arg
  187. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015149.1
  188. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015699.1
  189. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015898.1
  190. Linepithema humile (Argentine ant) transfer RNA arginine (anticodon UCG)
  191. Lucilia cuprina (Australian sheep blowfly) tRNA-Arg for anticodon UCG
  192. Lucilia sericata (Common green bottle fly) tRNA-Arg
  193. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  194. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011427.1
  195. Macrobrachium nipponense (Oriental river prawn) transfer RNA arginine (anticodon UCG)
  196. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA arginine (anticodon UCG)
  197. Manduca sexta (Tobacco hornworm) tRNA-Arg
  198. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Arg
  199. Megaselia scalaris (Coffin fly) tRNA-Arg for anticodon UCG
  200. Melanaphis sacchari (Sugarcane aphid) tRNA-Arg
  201. Melipona bicolor tRNA
  202. Melitaea cinxia misc RNA ENSMCXG00005023674.1
  203. Mesorhabditis belari tRNA
  204. Mesorhabditis spiculigera tRNA
  205. Microctonus aethiopoides tRNA
  206. Microctonus hyperodae tRNA
  207. Microplitis demolitor (Parasitoid wasp) transfer RNA arginine (anticodon UCG)
  208. Microplitis mediator (Endoparasitoid wasp) transfer RNA arginine (anticodon UCG)
  209. Molorchus minor tRNA-Arg
  210. Monomorium pharaonis (Pharaoh ant) tRNA-Arg
  211. Musca domestica (House fly) transfer RNA arginine (anticodon UCG)
  212. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013545.1
  213. Nasonia vitripennis tRNA-Arg
  214. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Arg
  215. Neodiprion pinetum (White pine sawfly) tRNA-Arg
  216. Nesidiocoris tenuis tRNA
  217. Nezara viridula (southern green stink bug) tRNA
  218. Nilaparvata lugens (Brown planthopper) tRNA-Arg
  219. Nylanderia fulva tRNA
  220. Onthophagus taurus tRNA-Arg
  221. Ooceraea biroi tRNA-Arg
  222. Operophtera brumata (winter moth) tRNA
  223. Orussus abietinus tRNA-Arg
  224. Oryctes borbonicus tRNA
  225. Papaver nudicaule tRNA
  226. Papaver somniferum (opium poppy) tRNA
  227. Papilio machaon tRNA
  228. Papilio xuthus tRNA
  229. Pararge aegeria aegeria tRNA
  230. Pararge aegeria tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 8)
  231. Arctia plantaginis Parasemia plantaginis tRNA
  232. Parnassius apollo (apollo) tRNA
  233. Pectinophora gossypiella (Pink bollworm) transfer RNA arginine (anticodon UCG)
  234. Pediculus humanus corporis tRNA tRNA-Arg
  235. Penaeus chinensis (Fleshy prawn) tRNA-Arg
  236. Penaeus japonicus tRNA-Arg
  237. Penaeus monodon (Black tiger shrimp) tRNA-Arg
  238. Penaeus vannamei (Pacific white shrimp) tRNA-Arg
  239. Phaedon cochleariae (mustard beetle) tRNA
  240. Photinus pyralis (Common eastern firefly) tRNA-Arg
  241. Phthorimaea operculella tRNA-Arg
  242. Phyllotreta striolata tRNA
  243. Pieris brassicae (large cabbage white) tRNA
  244. Pieris macdunnoughi tRNA
  245. Plodia interpunctella (Indianmeal moth) transfer RNA arginine (anticodon UCG)
  246. Plutella xylostella (diamondback moth) tRNA
  247. Pogonomyrmex barbatus tRNA-Arg
  248. Pogonomyrmex californicus tRNA-Arg
  249. Polistes canadensis tRNA-Arg
  250. Polistes dominula (European paper wasp) tRNA-Arg
  251. Polistes fuscatus (Common paper wasp) tRNA-Arg
  252. Polyplax serrata tRNA-Arg
  253. Portunus trituberculatus tRNA-Arg
  254. Procambarus clarkii (Red swamp crayfish) tRNA-Arg
  255. Pseudoatta argentina tRNA
  256. Psylliodes chrysocephalus Psylliodes chrysocephala tRNA
  257. Punica granatum tRNA
  258. Rhagoletis pomonella (Apple magot fly) tRNA-Arg
  259. Rhamnusium bicolor tRNA-Arg
  260. Rhodnius prolixus tRNA tRNA-Arg
  261. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Arg
  262. Rhynchophorus ferrugineus (red palm weevil) tRNA
  263. Scaptodrosophila lebanonensis tRNA
  264. Schistocerca americana tRNA-Arg
  265. Schistocerca cancellata (South American locust) transfer RNA arginine (anticodon UCG)
  266. Schistocerca gregaria (Grasshoppers) transfer RNA arginine (anticodon UCG)
  267. Schistocerca nitens (Vagrant locust) transfer RNA arginine (anticodon UCG)
  268. Schistocerca piceifrons (Central American locust) tRNA-Arg
  269. Schistocerca serialis cubense (Grasshoppers) transfer RNA arginine (anticodon UCG)
  270. Sipha flava tRNA-Arg
  271. Sitophilus oryzae tRNA-Arg
  272. Solenopsis invicta (Red fire ant) tRNA-Arg
  273. Spodoptera exigua (beet armyworm) tRNA
  274. Spodoptera frugiperda tRNA-Arg (TCG) (tRNA-Arg-TCG-3 1 to 7)
  275. Spodoptera littoralis tRNA
  276. Spodoptera litura tRNA
  277. Steinernema carpocapsae tRNA
  278. Steinernema glaseri tRNA
  279. Steinernema hermaphroditum tRNA
  280. Stomoxys calcitrans (stable fly) transfer RNA arginine (anticodon UCG)
  281. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Arg
  282. Temnothorax curvispinosus tRNA
  283. Temnothorax longispinosus tRNA
  284. Tenebrio molitor (yellow mealworm) tRNA
  285. Thrips palmi tRNA-Arg
  286. Trachymyrmex cornetzi tRNA
  287. Trachymyrmex septentrionalis tRNA
  288. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  289. Trialeurodes vaporariorum (Greenhouse whitefly) tRNA-Arg for anticodon UCG
  290. Tribolium castaneum transfer RNA arginine (anticodon UCG)
  291. Tribolium madens (Black flour beetle) tRNA-Arg
  292. Trichogramma brassicae tRNA
  293. Trichogramma pretiosum tRNA-Arg
  294. Trichomalopsis sarcophagae tRNA
  295. Trichoplusia ni (cabbage looper) tRNA
  296. Vanessa tameamea tRNA
  297. Venturia canescens tRNA-Arg
  298. Vespa mandarinia (Asian giant hornet) tRNA-Arg
  299. Vespula germanica tRNA
  300. Vespula pensylvanica (western yellowjacket) tRNA
  301. Vespula vulgaris tRNA
  302. Zerene cesonia (Southern Dogface) tRNA-Arg
  303. Zeugodacus cucurbitae (Melon fly) transfer RNA arginine (anticodon UCG)
  304. Zootermopsis nevadensis tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...