Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Dinoponera quadriceps (south american ant) tRNA secondary structure diagram

Dinoponera quadriceps (south american ant) tRNA URS000051488D_609295

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCGUGUGGCCUAAUGGAUAAGGCGUCGGACUUCGGAUCCGAAGAUUGCAGGUUCGAGUCCUGUCACGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 275 other species

  1. Acanthoscelides obtectus tRNA
  2. Acromyrmex charruanus tRNA
  3. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Arg
  4. Acromyrmex heyeri tRNA
  5. Acyrthosiphon pisum (Pea aphid) tRNA-Arg
  6. Adelges cooleyi (Spruce gall adelgid) transfer RNA arginine (anticodon UCG)
  7. Aedes aegypti (Yellow fever mosquito) tRNA AAEL016068
  8. Aegilops tauschii subsp. strangulata tRNA-Arg for anticodon UCG
  9. Aethina tumida (Small hive beetle) transfer RNA arginine (anticodon UCG)
  10. Agrilus planipennis tRNA-Arg
  11. Allacma fusca tRNA
  12. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011450.1
  13. Amyelois transitella (Naval orange worm) tRNA-Arg
  14. Anastrepha ludens (Mexican fruit fly) transfer RNA arginine (anticodon UCG)
  15. Anastrepha obliqua (WestIndian fruit fly) transfer RNA arginine (anticodon UCG)
  16. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000012001.1
  17. Anthonomus grandis grandis (Boll weevil) transfer RNA arginine (anticodon UCG)
  18. Aphis craccivora (cowpea aphid) tRNA
  19. Aphis glycines (soybean aphid) tRNA
  20. Aphis gossypii (cotton aphid) tRNA
  21. Apis cerana cerana tRNA
  22. Apis dorsata tRNA-Arg
  23. Apis florea (Dwarf honeybee) tRNA-Arg
  24. Apis mellifera tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  25. Apolygus lucorum tRNA
  26. Arabis alpina (gray rockcress) tRNA
  27. Armadillidium nasatum tRNA
  28. Aromia moschata tRNA-OTHER
  29. Asbolus verrucosus (desert ironclad beetle) tRNA
  30. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005004798.1
  31. Atta cephalotes tRNA LOC105616968-3
  32. Atta colombica tRNA
  33. Bactrocera dorsalis tRNA-Arg
  34. Bactrocera latifrons tRNA-Arg
  35. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA arginine (anticodon UCG)
  36. Bactrocera tryoni tRNA-Arg
  37. Bemisia tabaci tRNA
  38. Bicyclus anynana (Squinting bush brown) tRNA-Arg
  39. Blattella germanica tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  40. Bombus affinis (Rusty patched bumble bee) transfer RNA arginine (anticodon UCG)
  41. Bombus huntii (Hunt's bumblebee) transfer RNA arginine (anticodon UCG)
  42. Bombus terrestris tRNA LOC110119195
  43. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Arg
  44. Bombus vosnesenskii tRNA
  45. Bombyx mandarina (Wild silkworm) tRNA-Arg
  46. Bombyx mori tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 7)
  47. Brenthis ino (lesser marbled fritillary) tRNA
  48. Callosobruchus analis hypothetical protein
  49. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  50. Callosobruchus maculatus (cowpea weevil) tRNA
  51. Camponotus floridanus (Florida carpenter ant) tRNA-Arg
  52. Cataglyphis hispanica (Desert ant) transfer RNA arginine (anticodon UCG)
  53. Cephus cinctus (wheat stem sawfly) tRNA
  54. Ceratitis capitata tRNA-Arg
  55. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  56. Chelonus insularis (Parasitoid wasp) tRNA-Arg
  57. Cherax quadricarinatus (Australian red claw crayfish) transfer RNA arginine (anticodon UCG)
  58. Chionoecetes opilio (snow crab) tRNA
  59. Chrysodeixis includens tRNA
  60. Cimex lectularius (Bed bug) tRNA-Arg
  61. Cinara cedri tRNA
  62. Cloeon dipterum tRNA
  63. Copidosoma floridanum (Parasitoid wasp) tRNA-Arg
  64. Coptotermes formosanus (Formosan subterranean termite) tRNA
  65. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015228.1
  66. Cotesia congregata tRNA
  67. Cotesia glomerata tRNA-Arg
  68. Cotesia typhae tRNA
  69. Cryptolaemus montrouzieri tRNA-Arg
  70. Cryptotermes secundus tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  71. Ctenocephalides felis (Cat flea) tRNA-Arg
  72. Cucumis melo var. makuwa tRNA
  73. Culex pipiens pallens (Northern house mosquito) transfer RNA arginine (anticodon UCG)
  74. Culex quinquefasciatus tRNA-Arg
  75. Cylas formicarius (Sweet potato weevil) transfer RNA arginine (anticodon UCG)
  76. Cyphomyrmex costatus tRNA
  77. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA arginine (anticodon UCG)
  78. Danaus chrysippus (African queen) tRNA
  79. Danaus plexippus plexippus tRNA
  80. Dendroctonus ponderosae (Mountain pine beetle) tRNA-Arg
  81. Diabrotica balteata tRNA
  82. Diabrotica virgifera virgifera transfer RNA arginine (anticodon UCG)
  83. Diachasma alloeum tRNA
  84. Diaphorina citri (Asian citrus psyllid) tRNA-Arg
  85. Diatraea saccharalis (sugarcane borer) tRNA
  86. Diorhabda carinulata (Northern tamarisk beetle) transfer RNA arginine (anticodon UCG)
  87. Diorhabda sublineata (Subtropical tamarisk beetle) transfer RNA arginine (anticodon UCG)
  88. Diuraphis noxia tRNA-Arg
  89. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  90. Drosophila albomicans (Fruit fly) transfer RNA arginine (anticodon UCG)
  91. Drosophila ananassae tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 5)
  92. Drosophila arizonae (Fruit fly) tRNA-Arg
  93. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon UCG)
  94. Drosophila bipectinata (Fruit fly) tRNA-Arg
  95. Drosophila busckii (Fruit fly) tRNA-Arg
  96. Drosophila elegans (Fruit fly) tRNA-Arg
  97. Drosophila erecta tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  98. Drosophila eugracilis (Fruit fly) tRNA-Arg
  99. Drosophila ficusphila (Fruit fly) tRNA-Arg
  100. Drosophila grimshawi tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  101. Drosophila guanche (Fruit fly) tRNA-Arg
  102. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon UCG)
  103. Drosophila hydei (Fruit fly) tRNA-Arg
  104. Drosophila innubila (Fruit fly) tRNA-Arg
  105. Drosophila kikkawai (Fruit fly) tRNA-Arg
  106. Drosophila mauritiana (Fruit fly) tRNA-Arg
  107. Drosophila melanogaster transfer RNA:Arginine-TCG 2-3 (Dmel_CR31443, Dmel_CR32526, Dmel_CR32624, Dmel_CR33551)
  108. Drosophila miranda (Fruit fly) tRNA-Arg
  109. Drosophila mojavensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  110. Drosophila navojoa (Fruit fly) tRNA-Arg
  111. Drosophila obscura (Fruit fly) tRNA-Arg
  112. Drosophila persimilis tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  113. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  114. Drosophila pseudoobscura pseudoobscura tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  115. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  116. Drosophila santomea (Fruit fly) tRNA-Arg
  117. Drosophila sechellia tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  118. Drosophila simulans tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
  119. Drosophila subobscura (Fruit fly) tRNA-Arg
  120. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  121. Drosophila suzukii (Fruit fly) tRNA-Arg
  122. Drosophila takahashii (Fruit fly) tRNA-Arg
  123. Drosophila teissieri (Fruit fly) tRNA-Arg
  124. Drosophila virilis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  125. Drosophila willistoni tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  126. Drosophila yakuba tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  127. Dryococelus australis tRNA-OTHER
  128. Dufourea novaeangliae (Bee) tRNA-Arg
  129. Eriocheir sinensis (Chinese mitten crab) transfer RNA arginine (anticodon UCG)
  130. Eufriesea mexicana tRNA-Arg
  131. Eumeta japonica tRNA
  132. Exocentrus adspersus tRNA-OTHER
  133. Fopius arisanus tRNA
  134. Frankliniella occidentalis (western flower thrips) tRNA
  135. Frieseomelitta varia tRNA
  136. Galleria mellonella tRNA-Arg
  137. Glossina austeni tRNA tRNA-Arg
  138. Glossina brevipalpis tRNA tRNA-Arg
  139. Glossina fuscipes fuscipes tRNA
  140. Glossina morsitans morsitans tRNA tRNA-Arg
  141. Glossina pallidipes (Tsetse fly) tRNA tRNA-Arg
  142. Glossina palpalis gambiensis tRNA tRNA-Arg
  143. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014592.1
  144. Gossypium arboreum tRNA
  145. Habropoda laboriosa tRNA-Arg
  146. Halocaridina rubra tRNA-Arg
  147. Halyomorpha halys (Brown marmorated stink bug) tRNA-Arg
  148. Harpegnathos saltator tRNA-Arg
  149. Heliconius melpomene tRNA HMEL013664
  150. Helicoverpa armigera (Cotton bollworm) transfer RNA arginine (anticodon UCG)
  151. Helicoverpa zea (Corn earworm) tRNA-Arg
  152. Heliothis virescens (tobacco budworm) tRNA
  153. Henosepilachna vigintioctopunctata tRNA-Arg
  154. Hermetia illucens (Black soldier fly) tRNA-Arg
  155. Heterotrigona itama tRNA
  156. Homalodisca vitripennis tRNA-Arg
  157. Homarus americanus (American lobster) tRNA-Arg
  158. Homarus gammarus (European lobster) misc RNA ENSHGAG00000025494.1
  159. Hordeum vulgare subsp. vulgare (domesticated barley) tRNA
  160. Hyalella azteca (Amphipod) tRNA-Arg
  161. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA arginine (anticodon UCG)
  162. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA arginine (anticodon UCG)
  163. Hypothenemus hampei tRNA-Arg
  164. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005011511.1
  165. Ignelater luminosus (cucubano) tRNA
  166. Ladona fulva tRNA
  167. Laodelphax striatellus (small brown planthopper) tRNA
  168. Lasius niger tRNA
  169. Leguminivora glycinivorella tRNA-Arg
  170. Leptidea sinapis tRNA
  171. Leptinotarsa decemlineata tRNA-Arg
  172. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015149.1
  173. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015699.1
  174. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015898.1
  175. Lucilia cuprina (Australian sheep blowfly) tRNA-Arg for anticodon UCG
  176. Lupinus angustifolius tRNA
  177. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011427.1
  178. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA arginine (anticodon UCG)
  179. Manduca sexta (Tobacco hornworm) tRNA-Arg
  180. Megachile rotundata tRNA-Arg
  181. Megaselia scalaris tRNA-Arg for anticodon UCG
  182. Melanaphis sacchari (Sugarcane aphid) tRNA-Arg
  183. Melipona bicolor tRNA
  184. Melitaea cinxia (Glanville fritillary) misc RNA ENSMCXG00005023674.1
  185. Mesorhabditis belari tRNA
  186. Mesorhabditis spiculigera tRNA
  187. Microctonus aethiopoides tRNA
  188. Microctonus hyperodae tRNA
  189. Microplitis demolitor (Parasitoid wasp) transfer RNA arginine (anticodon UCG)
  190. Microplitis mediator (Endoparasitoid wasp) transfer RNA arginine (anticodon UCG)
  191. Molorchus minor tRNA-Arg
  192. Monomorium pharaonis tRNA-Arg
  193. Musca domestica tRNA MDOA013775
  194. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013038.1
  195. Nasonia vitripennis tRNA-Arg
  196. Neodiprion lecontei tRNA-Arg
  197. Neodiprion pinetum (White pine sawfly) tRNA-Arg
  198. Nesidiocoris tenuis tRNA
  199. Nezara viridula (southern green stink bug) tRNA
  200. Nilaparvata lugens tRNA-Arg
  201. Nylanderia fulva tRNA
  202. Onthophagus taurus tRNA-Arg
  203. Ooceraea biroi (Clonal raider ant) tRNA-Arg
  204. Operophtera brumata (winter moth) tRNA
  205. Orussus abietinus (Parasitic wood wasp) tRNA-Arg
  206. Oryctes borbonicus tRNA
  207. Papaver nudicaule tRNA
  208. Papaver somniferum (opium poppy) tRNA
  209. Papilio machaon tRNA
  210. Papilio xuthus tRNA
  211. Pararge aegeria aegeria tRNA
  212. Pararge aegeria tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 8)
  213. Arctia plantaginis Parasemia plantaginis tRNA
  214. Parnassius apollo (apollo) tRNA
  215. Pectinophora gossypiella (Pink bollworm) transfer RNA arginine (anticodon UCG)
  216. Pediculus humanus corporis tRNA tRNA-Arg
  217. Penaeus chinensis tRNA-Arg
  218. Penaeus japonicus (Kuruma shrimp) tRNA-Arg
  219. Penaeus monodon (Black tiger shrimp) tRNA-Arg
  220. Penaeus vannamei (Pacific white shrimp) tRNA-Arg
  221. Phaedon cochleariae (mustard beetle) tRNA
  222. Photinus pyralis (common eastern firefly) tRNA
  223. Phyllotreta striolata tRNA
  224. Pieris brassicae (large cabbage white) tRNA
  225. Pieris macdunnoughi tRNA
  226. Plodia interpunctella (Indianmeal moth) transfer RNA arginine (anticodon UCG)
  227. Plutella xylostella tRNA
  228. Pogonomyrmex barbatus (Red harvester ant) tRNA-Arg
  229. Polistes canadensis tRNA-Arg
  230. Polistes dominula tRNA-Arg
  231. Polistes fuscatus tRNA-Arg
  232. Polyplax serrata tRNA-Arg
  233. Portunus trituberculatus (Swimming crab) tRNA-Arg
  234. Procambarus clarkii (Red swamp crayfish) tRNA-Arg
  235. Pseudoatta argentina tRNA
  236. Psylliodes chrysocephalus Psylliodes chrysocephala tRNA
  237. Punica granatum tRNA
  238. Rhagoletis pomonella tRNA-Arg
  239. Rhamnusium bicolor tRNA-Arg
  240. Rhodnius prolixus tRNA tRNA-Arg
  241. Rhopalosiphum maidis tRNA-Arg
  242. Rhynchophorus ferrugineus (red palm weevil) tRNA
  243. Scaptodrosophila lebanonensis tRNA
  244. Schistocerca americana (American grasshopper) tRNA-Arg
  245. Schistocerca cancellata (South American locust) transfer RNA arginine (anticodon UCG)
  246. Schistocerca gregaria (Grasshoppers) transfer RNA arginine (anticodon UCG)
  247. Schistocerca nitens (Vagrant locust) transfer RNA arginine (anticodon UCG)
  248. Schistocerca piceifrons (Central American locust) tRNA-Arg
  249. Schistocerca serialis cubense (Grasshoppers) transfer RNA arginine (anticodon UCG)
  250. Sipha flava tRNA-Arg
  251. Sitophilus oryzae tRNA-Arg
  252. Solenopsis invicta (red fire ant) tRNA
  253. Spodoptera exigua (beet armyworm) tRNA
  254. Spodoptera frugiperda tRNA-Arg (TCG) (tRNA-Arg-TCG-3 1 to 7)
  255. Spodoptera littoralis tRNA
  256. Spodoptera litura tRNA
  257. Steinernema carpocapsae tRNA
  258. Steinernema glaseri tRNA
  259. Steinernema hermaphroditum tRNA
  260. Stomoxys calcitrans (Stable fly) tRNA-Arg
  261. Temnothorax curvispinosus tRNA
  262. Temnothorax longispinosus tRNA
  263. Tenebrio molitor (yellow mealworm) tRNA
  264. Thrips palmi tRNA-Arg
  265. Trachymyrmex cornetzi tRNA
  266. Trachymyrmex septentrionalis tRNA
  267. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  268. Trialeurodes vaporariorum tRNA-Arg for anticodon UCG
  269. Tribolium castaneum tRNA-Arg for anticodon UCG
  270. Tribolium madens (Black flour beetle) tRNA-Arg
  271. Trichogramma brassicae tRNA
  272. Trichogramma pretiosum (Parasitoid wasp) tRNA-Arg
  273. Trichomalopsis sarcophagae tRNA
  274. Trichoplusia ni (cabbage looper) tRNA
  275. Vanessa tameamea tRNA
  276. Venturia canescens tRNA-Arg
  277. Vespula germanica tRNA
  278. Vespula pensylvanica (western yellowjacket) tRNA
  279. Vespula vulgaris tRNA
  280. Zerene cesonia tRNA-Arg
  281. Zeugodacus cucurbitae (Melon fly) transfer RNA arginine (anticodon UCG)
  282. Zootermopsis nevadensis tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...