Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhagoletis pomonella (Apple magot fly) tRNA-Arg secondary structure diagram

Rhagoletis pomonella (Apple magot fly) tRNA-Arg URS000051488D_28610

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCGUGUGGCCUAAUGGAUAAGGCGUCGGACUUCGGAUCCGAAGAUUGCAGGUUCGAGUCCUGUCACGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 160 other species

  1. Acanthoscelides obtectus hypothetical protein
  2. Acromyrmex echinatior tRNA-Arg
  3. Acyrthosiphon pisum tRNA-Arg
  4. Adelges cooleyi (Spruce gall adelgid) transfer RNA arginine (anticodon UCG)
  5. Aedes aegypti tRNA AAEL016068
  6. Aegilops tauschii subsp. strangulata tRNA-Arg for anticodon UCG
  7. Aethina tumida (Small hive beetle) transfer RNA arginine (anticodon UCG)
  8. Agrilus planipennis tRNA-Arg
  9. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011450.1
  10. Amyelois transitella tRNA-Arg
  11. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000012001.1
  12. Anthonomus grandis grandis transfer RNA arginine (anticodon UCG)
  13. Apis dorsata (Giant honeybee) tRNA-Arg
  14. Apis florea tRNA-Arg
  15. Apis mellifera tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  16. Arabis alpina tRNA
  17. Aromia moschata tRNA-OTHER
  18. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005004798.1
  19. Atta cephalotes tRNA LOC105616968-3
  20. Atta colombica tRNA
  21. Bactrocera dorsalis (Oriental fruit fly) tRNA-Arg
  22. Bactrocera latifrons tRNA-Arg
  23. Bactrocera tryoni (Queensland fruitfly) tRNA-Arg
  24. Bicyclus anynana (Squinting bush brown) tRNA-Arg
  25. Blattella germanica tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  26. Bombus huntii (Hunt's bumblebee) transfer RNA arginine (anticodon UCG)
  27. Bombus terrestris tRNA LOC110119195
  28. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Arg
  29. Bombyx mandarina (Wild silkworm) tRNA-Arg
  30. Bombyx mori tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 7)
  31. Callosobruchus analis hypothetical protein
  32. Callosobruchus chinensis hypothetical protein
  33. Camponotus floridanus (Florida carpenter ant) tRNA-Arg
  34. Cataglyphis hispanica (Desert ant) transfer RNA arginine (anticodon UCG)
  35. Ceratitis capitata tRNA-Arg
  36. Chelonus insularis (Parasitoid wasp) tRNA-Arg
  37. Cimex lectularius tRNA-Arg
  38. Cinara cedri tRNA.Arg
  39. Copidosoma floridanum (Parasitoid wasp) tRNA-Arg
  40. Cotesia glomerata tRNA-Arg
  41. Cryptotermes secundus tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  42. Culex quinquefasciatus tRNA-Arg
  43. Cyphomyrmex costatus tRNA
  44. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA arginine (anticodon UCG)
  45. Danaus plexippus plexippus tRNA
  46. Dendroctonus ponderosae tRNA-Arg
  47. Diabrotica virgifera virgifera transfer RNA arginine (anticodon UCG)
  48. Diaphorina citri tRNA
  49. Diuraphis noxia (Russian wheat aphid) tRNA-Arg
  50. Drosophila ananassae tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 5)
  51. Drosophila busckii tRNA
  52. Drosophila erecta tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  53. Drosophila ficusphila tRNA
  54. Drosophila grimshawi tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  55. Drosophila guanche tRNA.Arg
  56. Drosophila gunungcola tRNA-OTHER
  57. Drosophila melanogaster (fruit fly) transfer RNA:Arginine-TCG 2-3 (Dmel_CR31443, Dmel_CR32526, Dmel_CR32624, Dmel_CR33551)
  58. Drosophila mojavensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  59. Drosophila persimilis tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  60. Drosophila pseudoobscura pseudoobscura tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  61. Drosophila sechellia tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  62. Drosophila simulans tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
  63. Drosophila virilis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  64. Drosophila willistoni tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  65. Drosophila yakuba tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  66. Dryococelus australis tRNA-OTHER
  67. Dufourea novaeangliae (Bee) tRNA-Arg
  68. Eufriesea mexicana tRNA-Arg
  69. Eumeta japonica tRNA-Arg
  70. Exocentrus adspersus tRNA-OTHER
  71. Frieseomelitta varia (marmelada) tRNA-Arg
  72. Galleria mellonella tRNA-Arg
  73. Glossina austeni (Tsetse fly) tRNA tRNA-Arg
  74. Glossina brevipalpis (Tsetse fly) tRNA tRNA-Arg
  75. Glossina fuscipes fuscipes tRNA
  76. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Arg
  77. Glossina pallidipes (Tsetse fly) tRNA tRNA-Arg
  78. Glossina palpalis gambiensis (Tsetse fly) tRNA tRNA-Arg
  79. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014592.1
  80. Gossypium arboreum tRNA
  81. Habropoda laboriosa (Southeastern blueberry bee) tRNA-Arg
  82. Harpegnathos saltator (Indian jumping ant) tRNA-Arg
  83. Heliconius melpomene (Postman butterfly) tRNA HMEL013664
  84. Helicoverpa armigera transfer RNA arginine (anticodon UCG)
  85. Helicoverpa zea tRNA-Arg
  86. Hermetia illucens (Black soldier fly) tRNA-Arg
  87. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Arg
  88. Homarus americanus tRNA-Arg
  89. Hordeum vulgare subsp. vulgare tRNA
  90. Hyalella azteca (Amphipod) tRNA-Arg
  91. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005011511.1
  92. Lasius niger tRNA
  93. Leguminivora glycinivorella (Soybean pod borer) tRNA-Arg
  94. Leptinotarsa decemlineata (Colorado potato beetle) tRNA-Arg
  95. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015149.1
  96. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015699.1
  97. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015898.1
  98. Lucilia cuprina tRNA-Arg for anticodon UCG
  99. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  100. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA arginine (anticodon UCG)
  101. Manduca sexta (Tobacco hornworm) tRNA-Arg
  102. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Arg
  103. Megaselia scalaris (Coffin fly) tRNA-Arg for anticodon UCG
  104. Melipona bicolor tRNA-Arg
  105. Melitaea cinxia misc RNA ENSMCXG00005023674.1
  106. Molorchus minor tRNA-Arg
  107. Monomorium pharaonis tRNA-Arg
  108. Musca domestica tRNA MDOA013775
  109. Nasonia vitripennis tRNA-Arg
  110. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Arg
  111. Neodiprion pinetum (White pine sawfly) tRNA-Arg
  112. Nilaparvata lugens (Brown planthopper) tRNA-Arg
  113. Onthophagus taurus (Dung beetle) tRNA-Arg
  114. Ooceraea biroi (Clonal raider ant) tRNA-Arg
  115. Operophtera brumata (winter moth) tRNA
  116. Orussus abietinus tRNA-Arg
  117. Oryctes borbonicus tRNA
  118. Papilio machaon tRNA
  119. Papilio xuthus tRNA
  120. Pararge aegeria tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 8)
  121. Pectinophora gossypiella (Pink bollworm) transfer RNA arginine (anticodon UCG)
  122. Pediculus humanus corporis tRNA tRNA-Arg
  123. Penaeus chinensis tRNA-Arg
  124. Penaeus japonicus tRNA-Arg
  125. Penaeus monodon (Black tiger shrimp) tRNA-Arg
  126. Penaeus vannamei (Pacific white shrimp) tRNA-Arg
  127. Plutella xylostella tRNA-Arg
  128. Pogonomyrmex barbatus tRNA-Arg
  129. Polistes canadensis tRNA-Arg
  130. Polistes dominula (European paper wasp) tRNA-Arg
  131. Polistes fuscatus tRNA-Arg
  132. Portunus trituberculatus tRNA-Arg
  133. Procambarus clarkii (Red swamp crayfish) tRNA-Arg
  134. Punica granatum tRNA
  135. Rhamnusium bicolor tRNA-Arg
  136. Rhodnius prolixus tRNA tRNA-Arg
  137. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Arg
  138. Schistocerca americana (American grasshopper) tRNA-Arg
  139. Schistocerca cancellata (South American locust) transfer RNA arginine (anticodon UCG)
  140. Schistocerca gregaria (Grasshoppers) transfer RNA arginine (anticodon UCG)
  141. Schistocerca nitens (Vagrant locust) transfer RNA arginine (anticodon UCG)
  142. Schistocerca piceifrons (Central American locust) tRNA-Arg
  143. Schistocerca serialis cubense (Grasshoppers) transfer RNA arginine (anticodon UCG)
  144. Sipha flava (Yellow sugarcane aphid) tRNA-Arg
  145. Sitophilus oryzae (Rice weevil) tRNA-Arg
  146. Solenopsis invicta tRNA
  147. Spodoptera frugiperda tRNA-Arg (TCG) (tRNA-Arg-TCG-3 1 to 7)
  148. Steinernema glaseri tRNA
  149. Stomoxys calcitrans tRNA-Arg
  150. Thrips palmi tRNA-Arg
  151. Trachymyrmex cornetzi tRNA
  152. Trachymyrmex septentrionalis tRNA
  153. Trachymyrmex zeteki tRNA
  154. Trialeurodes vaporariorum tRNA-Arg for anticodon UCG
  155. Tribolium castaneum tRNA-Arg for anticodon UCG
  156. Trichogramma pretiosum (Parasitoid wasp) tRNA-Arg
  157. Trichomalopsis sarcophagae tRNA
  158. Venturia canescens tRNA-Arg
  159. Zerene cesonia tRNA-Arg
  160. Zootermopsis nevadensis tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
2D structure