Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Rhamnusium bicolor tRNA-Arg secondary structure diagram

Rhamnusium bicolor tRNA-Arg URS000051488D_1586634

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACCGUGUGGCCUAAUGGAUAAGGCGUCGGACUUCGGAUCCGAAGAUUGCAGGUUCGAGUCCUGUCACGGUCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 298 other species

  1. Acanthoscelides obtectus tRNA
  2. Acromyrmex charruanus tRNA
  3. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Arg
  4. Acromyrmex heyeri tRNA
  5. Acyrthosiphon pisum (Pea aphid) tRNA-Arg
  6. Adelges cooleyi (Spruce gall adelgid) transfer RNA arginine (anticodon UCG)
  7. Aedes aegypti tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  8. Aegilops tauschii subsp. strangulata tRNA-Arg for anticodon UCG
  9. Aethina tumida (Small hive beetle) transfer RNA arginine (anticodon UCG)
  10. Agrilus planipennis tRNA-Arg
  11. Allacma fusca tRNA
  12. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011450.1
  13. Amyelois transitella (Moths) transfer RNA arginine (anticodon UCG)
  14. Anastrepha ludens (Mexican fruit fly) transfer RNA arginine (anticodon UCG)
  15. Anastrepha obliqua (WestIndian fruit fly) transfer RNA arginine (anticodon UCG)
  16. Ancistrocerus nigricornis (Potter wasp) misc RNA ENSANRG00000012001.1
  17. Anoplophora glabripennis (Asian long-horned beetle) tRNA-Arg
  18. Anthonomus grandis grandis transfer RNA arginine (anticodon UCG)
  19. Aphis craccivora (cowpea aphid) tRNA
  20. Aphis glycines (soybean aphid) tRNA
  21. Aphis gossypii (cotton aphid) tRNA
  22. Apis cerana cerana tRNA
  23. Apis dorsata (Giant honeybee) tRNA-Arg
  24. Apis florea tRNA-Arg
  25. Apis mellifera tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1)
  26. Apolygus lucorum tRNA
  27. Arabis alpina (gray rockcress) tRNA
  28. Armadillidium nasatum tRNA
  29. Armadillidium vulgare tRNA-Arg
  30. Aromia moschata tRNA-OTHER
  31. Asbolus verrucosus (desert ironclad beetle) tRNA
  32. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005004798.1
  33. Atta cephalotes tRNA LOC105616968-3
  34. Atta colombica tRNA
  35. Bactrocera dorsalis (Oriental fruit fly) transfer RNA arginine (anticodon UCG)
  36. Bactrocera latifrons tRNA-Arg
  37. Bactrocera neohumeralis (Lesser Queensland fruit fly) transfer RNA arginine (anticodon UCG)
  38. Bactrocera oleae (Olive fruit fly) tRNA-Arg
  39. Bactrocera tryoni (Queensland fruitfly) tRNA-Arg
  40. Bemisia tabaci tRNA
  41. Bicyclus anynana (squinting bush brown) misc RNA ENSINYG00000026295.1
  42. Blattella germanica tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  43. Bombus affinis (Rusty patched bumble bee) transfer RNA arginine (anticodon UCG)
  44. Bombus huntii (Hunt's bumblebee) transfer RNA arginine (anticodon UCG)
  45. Bombus impatiens (Common eastern bumblebee) tRNA-Arg
  46. Bombus terrestris (Bombus terrestris) misc RNA ENSBTSG00005027074.1
  47. Bombus vancouverensis nearcticus (Montane Bumble Bee) tRNA-Arg
  48. Bombus vosnesenskii tRNA
  49. Bombyx mandarina (Wild silkworm) tRNA-Arg
  50. Bombyx mori tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 7)
  51. Brenthis ino (lesser marbled fritillary) tRNA
  52. Callosobruchus analis hypothetical protein
  53. Callosobruchus chinensis (azuki bean weevil) hypothetical protein
  54. Callosobruchus maculatus (cowpea weevil) tRNA
  55. Camponotus floridanus tRNA-Arg
  56. Cataglyphis hispanica (Desert ant) transfer RNA arginine (anticodon UCG)
  57. Cephus cinctus (wheat stem sawfly) tRNA
  58. Ceratitis capitata tRNA-Arg
  59. Ceutorhynchus assimilis (cabbage seed weevil) tRNA
  60. Chelonus insularis tRNA-Arg
  61. Cherax quadricarinatus (Australian red claw crayfish) transfer RNA arginine (anticodon UCG)
  62. Chionoecetes opilio (snow crab) tRNA
  63. Chrysodeixis includens tRNA
  64. Chrysoperla carnea (Green lacewing) tRNA-Arg
  65. Cimex lectularius tRNA-Arg
  66. Cinara cedri tRNA
  67. Cloeon dipterum tRNA
  68. Copidosoma floridanum tRNA-Arg
  69. Coptotermes formosanus (Formosan subterranean termite) tRNA
  70. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015228.1
  71. Cotesia congregata tRNA
  72. Cotesia glomerata tRNA-Arg
  73. Cotesia typhae tRNA
  74. Cryptolaemus montrouzieri tRNA-Arg
  75. Cryptotermes secundus tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  76. Ctenocephalides felis (Cat flea) tRNA-Arg
  77. Cucumis melo var. makuwa tRNA
  78. Culex pipiens pallens (Northern house mosquito) transfer RNA arginine (anticodon UCG)
  79. Culex quinquefasciatus (southern house mosquito) tRNA
  80. Cydia pomonella (The codling moth) transfer RNA arginine (anticodon UCG)
  81. Cylas formicarius (Sweet potato weevil) transfer RNA arginine (anticodon UCG)
  82. Cyphomyrmex costatus tRNA
  83. Daktulosphaira vitifoliae (Grape phylloxera) transfer RNA arginine (anticodon UCG)
  84. Danaus chrysippus (African queen) tRNA
  85. Danaus plexippus (monarch butterfly) misc RNA ENSDPXG00000018449.1
  86. Danaus plexippus plexippus (Monarch butterfly) tRNA-Arg
  87. Dendroctonus ponderosae tRNA-Arg
  88. Diabrotica balteata tRNA
  89. Diabrotica virgifera virgifera (Western corn rootworm) transfer RNA arginine (anticodon UCG)
  90. Diachasma alloeum tRNA
  91. Diaphorina citri (Asian citrus psyllid) tRNA-Arg
  92. Diatraea saccharalis (sugarcane borer) tRNA
  93. Dinoponera quadriceps (south american ant) tRNA
  94. Diorhabda carinulata (Northern tamarisk beetle) transfer RNA arginine (anticodon UCG)
  95. Diorhabda sublineata (Subtropical tamarisk beetle) transfer RNA arginine (anticodon UCG)
  96. Diuraphis noxia tRNA-Arg
  97. Dolichomitus sp. PSUC_FEM 10030005 tRNA
  98. Drosophila albomicans (Fruit fly) transfer RNA arginine (anticodon UCG)
  99. Drosophila ananassae tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 5)
  100. Drosophila arizonae (Fruit fly) tRNA-Arg
  101. Drosophila biarmipes (Fruit fly) transfer RNA arginine (anticodon UCG)
  102. Drosophila bipectinata (Pomace flies) transfer RNA arginine (anticodon UCG)
  103. Drosophila busckii (Fruit fly) tRNA-Arg
  104. Drosophila elegans (Pomace flies) tRNA-Arg
  105. Drosophila erecta tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  106. Drosophila eugracilis (Fruit fly) tRNA-Arg
  107. Drosophila ficusphila (Fruit fly) tRNA-Arg
  108. Drosophila grimshawi tRNA-Arg (TCG) (tRNA-Arg-TCG-3-1)
  109. Drosophila guanche (Fruit fly) tRNA-Arg
  110. Drosophila gunungcola (Fruit fly) transfer RNA arginine (anticodon UCG)
  111. Drosophila hydei (Fruit fly) tRNA-Arg
  112. Drosophila innubila (Fruit fly) tRNA-Arg
  113. Drosophila kikkawai (Pomace flies) transfer RNA arginine (anticodon UCG)
  114. Drosophila mauritiana (Fruit fly) tRNA-Arg
  115. Drosophila melanogaster (fruit fly) transfer RNA:Arginine-TCG 2-3 (Dmel_CR31443, Dmel_CR32526, Dmel_CR32624, Dmel_CR33551)
  116. Drosophila miranda (Fruit fly) tRNA-Arg
  117. Drosophila mojavensis tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 3)
  118. Drosophila montana (Pomace flies) transfer RNA arginine (anticodon UCG)
  119. Drosophila nasuta (Pomace flies) transfer RNA arginine (anticodon UCG)
  120. Drosophila navojoa (Fruit fly) tRNA-Arg
  121. Drosophila novamexicana (Pomace flies) tRNA-Arg
  122. Drosophila obscura (Fruit fly) tRNA-Arg
  123. Drosophila persimilis tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  124. Drosophila pseudoobscura (Fruit fly) tRNA-Arg
  125. Drosophila pseudoobscura pseudoobscura tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  126. Drosophila rhopaloa (Fruit fly) tRNA-Arg
  127. Drosophila santomea (Fruit fly) tRNA-Arg
  128. Drosophila sechellia tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 3)
  129. Drosophila serrata (Pomace flies) tRNA-Arg
  130. Drosophila simulans tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
  131. Drosophila subobscura (Fruit fly) tRNA-Arg
  132. Drosophila subpulchrella (Fruit fly) tRNA-Arg
  133. Drosophila sulfurigaster albostrigata (Flies) transfer RNA arginine (anticodon UCG)
  134. Drosophila suzukii (Pomace flies) transfer RNA arginine (anticodon UCG)
  135. Drosophila takahashii (Pomace flies) transfer RNA arginine (anticodon UCG)
  136. Drosophila teissieri (Fruit fly) tRNA-Arg
  137. Drosophila tropicalis (Pomace flies) transfer RNA arginine (anticodon UCG)
  138. Drosophila virilis tRNA-Arg (TCG) (tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-2-2)
  139. Drosophila willistoni tRNA-Arg (TCG) (tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-1-2)
  140. Drosophila yakuba tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 6)
  141. Dryococelus australis tRNA-OTHER
  142. Dufourea novaeangliae tRNA-Arg
  143. Eriocheir sinensis (Chinese mitten crab) transfer RNA arginine (anticodon UCG)
  144. Eufriesea mexicana (Bee) tRNA-Arg
  145. Eumeta japonica tRNA
  146. Exocentrus adspersus tRNA-OTHER
  147. Fopius arisanus tRNA
  148. Frankliniella occidentalis (western flower thrips) tRNA
  149. Frieseomelitta varia tRNA
  150. Galleria mellonella (greater wax moth) tRNA
  151. Glossina austeni tRNA tRNA-Arg
  152. Glossina brevipalpis tRNA tRNA-Arg
  153. Glossina fuscipes fuscipes tRNA
  154. Glossina fuscipes (Tsetse fly) tRNA-Arg
  155. Glossina morsitans morsitans (Tsetse fly) tRNA tRNA-Arg
  156. Glossina pallidipes tRNA tRNA-Arg
  157. Glossina palpalis gambiensis tRNA tRNA-Arg
  158. Glyphotaelius pellucidus (Caddisflies) misc RNA ENSGPLG00000014592.1
  159. Gossypium arboreum tRNA
  160. Habropoda laboriosa tRNA-Arg
  161. Halocaridina rubra tRNA-Arg
  162. Halyomorpha halys (Brown marmorated stink bug) tRNA-Arg
  163. Harpegnathos saltator tRNA-Arg
  164. Heliconius melpomene (Postman butterfly) tRNA HMEL013664
  165. Helicoverpa armigera transfer RNA arginine (anticodon UCG)
  166. Helicoverpa zea tRNA-Arg
  167. Heliothis virescens (tobacco budworm) tRNA
  168. Henosepilachna vigintioctopunctata tRNA-Arg
  169. Hermetia illucens tRNA-Arg
  170. Heterotrigona itama tRNA
  171. Homalodisca vitripennis (Glassy winged sharpshooter) tRNA-Arg
  172. Homarus americanus tRNA-Arg
  173. Homarus gammarus (European lobster) misc RNA ENSHGAG00000025494.1
  174. Hordeum vulgare subsp. vulgare (domesticated barley) tRNA
  175. Hyalella azteca (Amphipod) tRNA-Arg
  176. Hylaeus anthracinus (Anthricinan yellow-faced bee) transfer RNA arginine (anticodon UCG)
  177. Hylaeus volcanicus (Volcano Masked Bee) transfer RNA arginine (anticodon UCG)
  178. Hypothenemus hampei tRNA-Arg
  179. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005011511.1
  180. Ignelater luminosus (cucubano) tRNA
  181. Ischnura elegans (Damselflies) tRNA-Arg
  182. Ladona fulva tRNA
  183. Laodelphax striatellus (small brown planthopper) tRNA
  184. Lasius niger tRNA
  185. Leguminivora glycinivorella (Soybean pod borer) tRNA-Arg
  186. Leptidea sinapis tRNA
  187. Leptinotarsa decemlineata tRNA-Arg
  188. Limnephilus lunatus (Caddisflies) misc RNA ENSLLSG00015015149.1
  189. Limnephilus marmoratus (Caddisflies) misc RNA ENSLMMG00005015699.1
  190. Limnephilus rhombicus (Caddisflies) misc RNA ENSLRHG00005015898.1
  191. Linepithema humile (Argentine ant) transfer RNA arginine (anticodon UCG)
  192. Lucilia cuprina (Australian sheep blowfly) tRNA-Arg for anticodon UCG
  193. Lucilia sericata (Common green bottle fly) tRNA-Arg
  194. Lupinus angustifolius (narrow-leaved blue lupine) tRNA
  195. Machimus atricapillus (Kite-tailed Robberfly) misc RNA ENSAMHG00005011427.1
  196. Macrobrachium nipponense (Oriental river prawn) transfer RNA arginine (anticodon UCG)
  197. Macrosteles quadrilineatus (Aster leafhopper) transfer RNA arginine (anticodon UCG)
  198. Manduca sexta (Tobacco hornworm) tRNA-Arg
  199. Megachile rotundata (Alfalfa leafcutting bee) tRNA-Arg
  200. Megaselia scalaris (Coffin fly) tRNA-Arg for anticodon UCG
  201. Melanaphis sacchari (Sugarcane aphid) tRNA-Arg
  202. Melipona bicolor tRNA
  203. Melitaea cinxia misc RNA ENSMCXG00005023674.1
  204. Mesorhabditis belari tRNA
  205. Mesorhabditis spiculigera tRNA
  206. Microctonus aethiopoides tRNA
  207. Microctonus hyperodae tRNA
  208. Microplitis demolitor (Parasitoid wasp) transfer RNA arginine (anticodon UCG)
  209. Microplitis mediator (Endoparasitoid wasp) transfer RNA arginine (anticodon UCG)
  210. Molorchus minor tRNA-Arg
  211. Monomorium pharaonis (Pharaoh ant) tRNA-Arg
  212. Musca domestica (House fly) transfer RNA arginine (anticodon UCG)
  213. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013545.1
  214. Nasonia vitripennis tRNA-Arg
  215. Neodiprion lecontei (Redheaded pine sawfly) tRNA-Arg
  216. Neodiprion pinetum (White pine sawfly) tRNA-Arg
  217. Nesidiocoris tenuis tRNA
  218. Nezara viridula (southern green stink bug) tRNA
  219. Nilaparvata lugens (Brown planthopper) tRNA-Arg
  220. Nylanderia fulva tRNA
  221. Onthophagus taurus tRNA-Arg
  222. Ooceraea biroi tRNA-Arg
  223. Operophtera brumata (winter moth) tRNA
  224. Orussus abietinus tRNA-Arg
  225. Oryctes borbonicus tRNA
  226. Papaver nudicaule tRNA
  227. Papaver somniferum (opium poppy) tRNA
  228. Papilio machaon tRNA
  229. Papilio xuthus tRNA
  230. Pararge aegeria aegeria tRNA
  231. Pararge aegeria tRNA-Arg (TCG) (tRNA-Arg-TCG-2 1 to 8)
  232. Arctia plantaginis Parasemia plantaginis tRNA
  233. Parnassius apollo (apollo) tRNA
  234. Pectinophora gossypiella (Pink bollworm) transfer RNA arginine (anticodon UCG)
  235. Pediculus humanus corporis tRNA tRNA-Arg
  236. Penaeus chinensis (Fleshy prawn) tRNA-Arg
  237. Penaeus japonicus tRNA-Arg
  238. Penaeus monodon (Black tiger shrimp) tRNA-Arg
  239. Penaeus vannamei (Pacific white shrimp) tRNA-Arg
  240. Phaedon cochleariae (mustard beetle) tRNA
  241. Photinus pyralis (Common eastern firefly) tRNA-Arg
  242. Phthorimaea operculella tRNA-Arg
  243. Phyllotreta striolata tRNA
  244. Pieris brassicae (large cabbage white) tRNA
  245. Pieris macdunnoughi tRNA
  246. Plodia interpunctella (Indianmeal moth) transfer RNA arginine (anticodon UCG)
  247. Plutella xylostella (diamondback moth) tRNA
  248. Pogonomyrmex barbatus tRNA-Arg
  249. Pogonomyrmex californicus tRNA-Arg
  250. Polistes canadensis tRNA-Arg
  251. Polistes dominula (European paper wasp) tRNA-Arg
  252. Polistes fuscatus (Common paper wasp) tRNA-Arg
  253. Polyplax serrata tRNA-Arg
  254. Portunus trituberculatus tRNA-Arg
  255. Procambarus clarkii (Red swamp crayfish) tRNA-Arg
  256. Pseudoatta argentina tRNA
  257. Psylliodes chrysocephalus Psylliodes chrysocephala tRNA
  258. Punica granatum tRNA
  259. Rhagoletis pomonella (Apple magot fly) tRNA-Arg
  260. Rhodnius prolixus tRNA tRNA-Arg
  261. Rhopalosiphum maidis (Corn leaf aphid) tRNA-Arg
  262. Rhynchophorus ferrugineus (red palm weevil) tRNA
  263. Scaptodrosophila lebanonensis tRNA
  264. Schistocerca americana tRNA-Arg
  265. Schistocerca cancellata (South American locust) transfer RNA arginine (anticodon UCG)
  266. Schistocerca gregaria (Grasshoppers) transfer RNA arginine (anticodon UCG)
  267. Schistocerca nitens (Vagrant locust) transfer RNA arginine (anticodon UCG)
  268. Schistocerca piceifrons (Central American locust) tRNA-Arg
  269. Schistocerca serialis cubense (Grasshoppers) transfer RNA arginine (anticodon UCG)
  270. Sipha flava tRNA-Arg
  271. Sitophilus oryzae tRNA-Arg
  272. Solenopsis invicta (Red fire ant) tRNA-Arg
  273. Spodoptera exigua (beet armyworm) tRNA
  274. Spodoptera frugiperda tRNA-Arg (TCG) (tRNA-Arg-TCG-3 1 to 7)
  275. Spodoptera littoralis tRNA
  276. Spodoptera litura tRNA
  277. Steinernema carpocapsae tRNA
  278. Steinernema glaseri tRNA
  279. Steinernema hermaphroditum tRNA
  280. Stomoxys calcitrans (stable fly) transfer RNA arginine (anticodon UCG)
  281. Teleopsis dalmanni (Malaysian stalk-eyed fly) tRNA-Arg
  282. Temnothorax curvispinosus tRNA
  283. Temnothorax longispinosus tRNA
  284. Tenebrio molitor (yellow mealworm) tRNA
  285. Thrips palmi tRNA-Arg
  286. Trachymyrmex cornetzi tRNA
  287. Trachymyrmex septentrionalis tRNA
  288. Mycetomoellerius zeteki Trachymyrmex zeteki tRNA
  289. Trialeurodes vaporariorum (Greenhouse whitefly) tRNA-Arg for anticodon UCG
  290. Tribolium castaneum transfer RNA arginine (anticodon UCG)
  291. Tribolium madens (Black flour beetle) tRNA-Arg
  292. Trichogramma brassicae tRNA
  293. Trichogramma pretiosum tRNA-Arg
  294. Trichomalopsis sarcophagae tRNA
  295. Trichoplusia ni (cabbage looper) tRNA
  296. Vanessa tameamea tRNA
  297. Venturia canescens tRNA-Arg
  298. Vespa mandarinia (Asian giant hornet) tRNA-Arg
  299. Vespula germanica tRNA
  300. Vespula pensylvanica (western yellowjacket) tRNA
  301. Vespula vulgaris tRNA
  302. Zerene cesonia (Southern Dogface) tRNA-Arg
  303. Zeugodacus cucurbitae (Melon fly) transfer RNA arginine (anticodon UCG)
  304. Zootermopsis nevadensis tRNA-Arg (TCG) (tRNA-Arg-TCG-1 1 to 4)
Relationships

Molecular Relationships

2D structure

Loading 2D structure...