Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-203a-3p URS00004DA9DB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-203a: Hsa-mir-203a is a miRNA precursor that has been studied in various contexts. In one study, mimetic miRNAs, including hsa-mir-203a, were transfected in KCR and MCF-7 cells [PMC8992503]. Another study found that hsa-mir-203a was downregulated in a model comparing smokers without COPD at baseline and after follow-up [PMC7605612]. Additionally, hsa-mir-203a was found to be downregulated in diabetic patients and may be involved in protecting bone from fracture [PMC7288911]. In a diagnostic signature formula, hsa-mir-203a was assigned a negative coefficient, suggesting its potential as a biomarker [PMC7772397]. Furthermore, hsa-mir-203a has been identified as a tumor suppressor and its overexpression inhibits cell proliferation, invasion, and migration [PMC8907292]. Overall, these studies highlight the importance of hsa-mir-203a in various biological processes and its potential as a diagnostic biomarker.

mRNA interactions 9 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAAUGUUUAGGACCACUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications