Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Echinops telfairi (small Madagascar hedgehog) Ete-Mir-203-v1_3p (mature (guide)) URS00004DA9DB_9371

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAAUGUUUAGGACCACUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus (cattle) Bta-Mir-203-v1_3p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-203
  3. Canis lupus familiaris cfa-miR-203
  4. Capra hircus miR-203
  5. Cavia porcellus cpo-miR-203-3p
  6. Cervus elaphus cel-miR-203
  7. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-203-v1_3p (mature (guide))
  8. Homo sapiens (human) hsa-miR-203a-3p
  9. Macaca mulatta mml-miR-203
  10. Mus musculus (house mouse) mmu-miR-203-3p
  11. Oryctolagus cuniculus Ocu-Mir-203-v1_3p (mature (guide))
  12. Ovis aries (sheep) miscellaneous RNA
  13. Pan troglodytes (chimpanzee) ptr-miR-203
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-203
  15. Rattus norvegicus rno-miR-203a-3p