Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-203a-3p URS00004DA9DB_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-203: Rno-mir-203 is a microRNA that has been studied in the context of ischemia and acute kidney injury (AKI) [PMC7943304]. KEGG and Wiki analyses have identified several functional categories modulated by rno-mir-203, including metabolic pathways, mRNA processing, cancer pathways, ubiquitin-mediated proteolysis, MAPK signaling, TGF-β signaling pathway, and TGF-β receptor signaling pathway [PMC4178201]. Rno-mir-203 is predicted to have 386 target genes [PMC4178201]. Methylation-specific primers were designed to study the methylation status of rno-mir-203 promoter [PMC4950120]. The downregulation of rno-mir-203 in AKI may be due to its methylation status [PMC4950120]. The levels of rno-mir-203 were significantly reduced in H/R or antimycin A-treated cells compared to normal cells [PMC4950120]. Rno-mir-203 may attenuate Aldosterone-induced cell apoptosis by inhibiting death receptor and mitochondrial apoptotic signaling pathways [PMC4950120]. Kim-1 has been identified as a direct target gene of rno-mir-203 in NRK52E cells through luciferase reporter assays [PMC4950120]. The levels of rno-mir 203 were significantly increased when I/R mice were treated with spironolactone compared to untreated mice [PMC4950120].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUGAAAUGUUUAGGACCACUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

Publications