v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) miscellaneous RNA URS00004DA9DB_9940

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGAAAUGUUUAGGACCACUAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus (cattle) Bta-Mir-203-v1_3p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-203
  3. Canis lupus familiaris cfa-miR-203
  4. Capra hircus miR-203
  5. Cavia porcellus cpo-miR-203-3p
  6. Cervus elaphus cel-miR-203
  7. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-203-v1_3p (mature (guide))
  8. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-203-v1_3p (mature (guide))
  9. Homo sapiens (human) hsa-miR-203a-3p
  10. Macaca mulatta mml-miR-203
  11. Mus musculus (house mouse) mmu-miR-203-3p
  12. Oryctolagus cuniculus Ocu-Mir-203-v1_3p (mature (guide))
  13. Pan troglodytes (chimpanzee) ptr-miR-203
  14. Pongo pygmaeus (Bornean orangutan) ppy-miR-203
  15. Rattus norvegicus rno-miR-203a-3p