Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan troglodytes (chimpanzee) ptr-miR-370 URS00004900F1_9598

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUGCUGGGGUGGAACCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-370
  2. Canis lupus familiaris cfa-miR-370
  3. Cavia porcellus (domestic guinea pig) cpo-miR-370-3p
  4. Cervus elaphus (red deer) cel-miR-370
  5. Eptesicus fuscus efu-miR-370
  6. Equus caballus eca-miR-370
  7. Homo sapiens (human) hsa-miR-370-3p
  8. Macaca mulatta mml-miR-370-3p
  9. Mus musculus mmu-miR-370-3p
  10. Oryctolagus cuniculus ocu-miR-370-3p
  11. Pan paniscus ppa-miR-370
  12. Pongo pygmaeus ppy-miR-370
  13. Rattus norvegicus (Norway rat) rno-miR-370-3p
  14. Sus scrofa (pig) ssc-miR-370
Publications