Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-370 URS00004900F1_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-370: ssc-mir-370 is a miRNA that has been identified as an important regulator of pig subcutaneous adipocytes and the differentiation process of subcutaneous adipocytes [PMC8834144]. It targets a large number of genes involved in the regulation of fat metabolism and is associated with pathways related to adipocytokine signaling, MAPK signaling, and glucose metabolism [PMC8834144]. ssc-mir-370 has also been found to target genes such as HHAT and GRIN3A, which are important candidates for the regulation of porcine subcutaneous adipocyte differentiation [PMC8834144]. Additionally, ssc-mir-370 has been implicated in the regulation of intramuscular fat deposition and collagen via protein digestion and absorption pathways [PMC9454643]. It has been found to be downregulated in intramuscular adipose tissue and associated with the upregulation of genes such as COL5A3 in pigs [PMC9454643]. Furthermore, ssc-mir-370 has been identified as a regulator involved in precocious sexual maturation traits in HZ boars, targeting the SPATA3 gene [PMC9622794]. It is also involved in regulatory networks related to mRNA-miRNA-lncRNA interactions and mRNA-miRNA-circRNA interactions [PMC8614448]. Overall, ssc-mir-370 plays a crucial role in various biological processes related to fat metabolism, tissue development, and sexual maturation.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUGCUGGGGUGGAACCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-370
  2. Canis lupus familiaris cfa-miR-370
  3. Cavia porcellus (domestic guinea pig) cpo-miR-370-3p
  4. Cervus elaphus (red deer) cel-miR-370
  5. Eptesicus fuscus efu-miR-370
  6. Equus caballus eca-miR-370
  7. Homo sapiens (human) hsa-miR-370-3p
  8. Macaca mulatta mml-miR-370-3p
  9. Mus musculus mmu-miR-370-3p
  10. Oryctolagus cuniculus ocu-miR-370-3p
  11. Pan paniscus ppa-miR-370
  12. Pan troglodytes (chimpanzee) ptr-miR-370
  13. Pongo pygmaeus ppy-miR-370
  14. Rattus norvegicus (Norway rat) rno-miR-370-3p
Publications