Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-370 URS00004900F1_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-370: Bta-mir-370 is a differentially expressed circular RNA (circRNA) that has been found to have regulatory relationships with various miRNAs and target genes [PMC8946036]. In silico analysis has shown that bta-mir-370 is associated with the highest number of target genes [PMC7937231]. It has been selected for further analysis along with its target gene interleukin 10 receptor subunit beta (IL-10RB) [PMC7937231]. Bta-mir-370 is one of the miRNAs that are exclusively expressed in cows with negative energy status and is found on chromosome 21 [PMC6731312]. Interestingly, among the numerous lipid metabolism-related differential miRNAs, bta-mir-370 is the only upregulated differential miRNA, while the rest are downregulated [PMC8850724]. Bta-mir-370 has regulatory relationships with genes such as MTM1, ANO1, PLA2G15, and FADS2 [PMC8850724]. Overall, bta-mir-370 is a differentially expressed circRNA that plays a role in regulatory relationships with various miRNAs and target genes. It has been found to be associated with negative energy status in cows and has implications for lipid metabolism-related processes. Further analysis of its regulatory relationships may provide insights into its functional role in biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUGCUGGGGUGGAACCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Canis lupus familiaris cfa-miR-370
  2. Cavia porcellus (domestic guinea pig) cpo-miR-370-3p
  3. Cervus elaphus (red deer) cel-miR-370
  4. Eptesicus fuscus efu-miR-370
  5. Equus caballus eca-miR-370
  6. Homo sapiens (human) hsa-miR-370-3p
  7. Macaca mulatta mml-miR-370-3p
  8. Mus musculus mmu-miR-370-3p
  9. Oryctolagus cuniculus ocu-miR-370-3p
  10. Pan paniscus ppa-miR-370
  11. Pan troglodytes (chimpanzee) ptr-miR-370
  12. Pongo pygmaeus ppy-miR-370
  13. Rattus norvegicus (Norway rat) rno-miR-370-3p
  14. Sus scrofa (pig) ssc-miR-370
Publications