Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-370 URS00004900F1_9796

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

eca-mir-370: Eca-mir-370 is an upregulated microRNA (miRNA) in undescended testes (UDTs) compared to descended testes (DTs) in donkeys [PMC7070967]. It is involved in controlling muscle fiber composition by targeting genes mainly involved in actin binding and the glycolysis/gluconeogenesis pathways [PMC9498731]. The expression of eca-mir-370 was found to be upregulated in UDTs compared to DTs, consistent with the sequencing method [PMC7070967]. Several genes, including TPM2, TNNC1, TNNI1, MYH14, and ACADS, were predicted to be targets of eca-mir-370 and were more highly expressed in slow muscle fibers [PMC9498731]. Additionally, TNNC1, TPM2, TNNI1, and MYH14 were targets of the upregulated eca-mir-370 and enriched in PM (posterior muscle) [PMC9498731]. Eca-miR-193a-5p and eca-mir-370 were identified as microRNAs involved in actin binding and the glycolysis/gluconeogenesis pathways that potentially coregulate muscle fiber types [PMC9498731]. Eca-miR-199b-5p, eca-mir-370, and eca-miR-758 were upregulated miRNAs in BF (biceps femoris), while eca-miR-196b, eca-miR196a,e miR192,e miR6153p,e miR4993p,e miR128,and emiRNA1935p were downregulated miRNAs [PMC9498731]. Eca-miRNA1935p ,eca-MIR1379,and emiRNA370 showed large numbers of target genes in the networks [PMC9498731]. However, further studies are needed to validate these findings and understand the complex regulatory mechanisms involved [PMC9498731].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUGCUGGGGUGGAACCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-370
  2. Canis lupus familiaris cfa-miR-370
  3. Cavia porcellus (domestic guinea pig) cpo-miR-370-3p
  4. Cervus elaphus (red deer) cel-miR-370
  5. Eptesicus fuscus efu-miR-370
  6. Homo sapiens (human) hsa-miR-370-3p
  7. Macaca mulatta mml-miR-370-3p
  8. Mus musculus mmu-miR-370-3p
  9. Oryctolagus cuniculus ocu-miR-370-3p
  10. Pan paniscus ppa-miR-370
  11. Pan troglodytes (chimpanzee) ptr-miR-370
  12. Pongo pygmaeus ppy-miR-370
  13. Rattus norvegicus (Norway rat) rno-miR-370-3p
  14. Sus scrofa (pig) ssc-miR-370
Publications