Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-370 URS00004900F1_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-370: Cfa-mir-370, a microRNA, was found to be significantly downregulated at 36 dpi (days post-infection) [PMC7689213]. It was identified to target the CD3E gene [PMC7689213]. Several miRNAs, including cfa-mir-370, cfa-miR-133c, novel-294, and cfa-miR-88, were associated with immune responses [PMC7689213]. The downregulation of cfa-mir-370 in infected livers at 36 dpi suggests its potential role in the immune reaction against T. canis infection [PMC7689213]. Additionally, cfa-mir-370 and cfa-miR-133c were predicted to regulate the ARRDC1 gene [PMC7689213]. The study also validated the differential expression of several miRNAs, including cfa-mir-370, using qRT-PCR [PMC5844969].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCUGCUGGGGUGGAACCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Bos taurus bta-miR-370
  2. Cavia porcellus (domestic guinea pig) cpo-miR-370-3p
  3. Cervus elaphus (red deer) cel-miR-370
  4. Eptesicus fuscus efu-miR-370
  5. Equus caballus eca-miR-370
  6. Homo sapiens (human) hsa-miR-370-3p
  7. Macaca mulatta mml-miR-370-3p
  8. Mus musculus mmu-miR-370-3p
  9. Oryctolagus cuniculus ocu-miR-370-3p
  10. Pan paniscus ppa-miR-370
  11. Pan troglodytes (chimpanzee) ptr-miR-370
  12. Pongo pygmaeus ppy-miR-370
  13. Rattus norvegicus (Norway rat) rno-miR-370-3p
  14. Sus scrofa (pig) ssc-miR-370
Publications