Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila busckii (Fruit fly) tRNA-Glu secondary structure diagram

Drosophila busckii (Fruit fly) tRNA-Glu URS000048030A_30019

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCAUAUUGUCUAGUGGUUAGGAUACCCGGCUCUCACCCGGGAGGCCCGGGUUCAAUUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 49 other species

  1. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015322.1
  2. Daphnia carinata (Water flea) transfer RNA glutamic acid (anticodon CUC)
  3. Daphnia galeata tRNA
  4. Daphnia magna (Fresh water planktonic) tRNA-Glu
  5. Daphnia pulex (Common water flea) tRNA-Glu
  6. Daphnia pulicaria tRNA-Glu
  7. Drosophila albomicans (Fruit fly) transfer RNA glutamic acid (anticodon CUC)
  8. Drosophila biarmipes (Fruit fly) transfer RNA glutamic acid (anticodon CUC)
  9. Drosophila elegans (Pomace flies) tRNA-Glu
  10. Drosophila erecta tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 3)
  11. Drosophila eugracilis (Fruit fly) tRNA-Glu
  12. Drosophila ficusphila (Fruit fly) tRNA-Glu
  13. Drosophila grimshawi tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  14. Drosophila guanche (Fruit fly) tRNA-Glu
  15. Drosophila gunungcola (Fruit fly) transfer RNA glutamic acid (anticodon CUC)
  16. Drosophila hydei (Fruit fly) tRNA-Glu
  17. Drosophila innubila (Fruit fly) tRNA-Glu
  18. Drosophila kikkawai (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  19. Drosophila mauritiana (Fruit fly) tRNA-Glu
  20. Drosophila melanogaster transfer RNA:Glutamic acid-CTC 2-2 (Dmel_CR30220, Dmel_CR30454, Dmel_CR32460)
  21. Drosophila miranda (Fruit fly) tRNA-Glu
  22. Drosophila mojavensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  23. Drosophila montana (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  24. Drosophila nasuta (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  25. Drosophila navojoa (Fruit fly) tRNA-Glu
  26. Drosophila novamexicana (Pomace flies) tRNA-Glu
  27. Drosophila obscura (Fruit fly) tRNA-Glu
  28. Drosophila persimilis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12)
  29. Drosophila pseudoobscura (Fruit fly) tRNA-Glu
  30. Drosophila pseudoobscura pseudoobscura tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 10)
  31. Drosophila rhopaloa (Fruit fly) tRNA-Glu
  32. Drosophila santomea (Fruit fly) tRNA-Glu
  33. Drosophila sechellia tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 3)
  34. Drosophila serrata (Pomace flies) tRNA-Glu
  35. Drosophila simulans tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  36. Drosophila subobscura (Fruit fly) tRNA-Glu
  37. Drosophila subpulchrella (Fruit fly) tRNA-Glu
  38. Drosophila sulfurigaster albostrigata (Flies) transfer RNA glutamic acid (anticodon CUC)
  39. Drosophila suzukii (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  40. Drosophila takahashii (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  41. Drosophila teissieri (Fruit fly) tRNA-Glu
  42. Drosophila tropicalis (Pomace flies) transfer RNA glutamic acid (anticodon CUC)
  43. Drosophila virilis tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  44. Drosophila willistoni tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1, tRNA-Glu-CTC-2-2)
  45. Drosophila yakuba tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 5)
  46. Myopa tessellatipennis (flies) misc RNA ENSMTEG00005013314.1
  47. Scaptodrosophila lebanonensis tRNA
  48. soil metagenome tRNA
  49. Stenomitos sp. tRNA-Glu
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications