Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila sechellia tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 3) secondary structure diagram

Drosophila sechellia tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 3) URS000048030A_7238

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCAUAUUGUCUAGUGGUUAGGAUACCCGGCUCUCACCCGGGAGGCCCGGGUUCAAUUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Daphnia galeata transfer RNA
  2. Daphnia magna tRNA-Glu
  3. Daphnia pulex tRNA-Glu
  4. Daphnia pulicaria tRNA-Glu
  5. Drosophila busckii tRNA
  6. Drosophila erecta tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 3)
  7. Drosophila ficusphila tRNA
  8. Drosophila grimshawi tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  9. Drosophila guanche tRNA.Glu
  10. Drosophila gunungcola tRNA-OTHER
  11. Drosophila melanogaster (fruit fly) transfer RNA:Glutamic acid-CTC 2-2 (Dmel_CR30220, Dmel_CR30454, Dmel_CR32460)
  12. Drosophila mojavensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  13. Drosophila persimilis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12)
  14. Drosophila pseudoobscura pseudoobscura tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 10)
  15. Drosophila simulans tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  16. Drosophila virilis tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  17. Drosophila willistoni tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1, tRNA-Glu-CTC-2-2)
  18. Drosophila yakuba tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 5)
2D structure Publications