v26

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Drosophila pseudoobscura (Fruit fly) tRNA-Glu secondary structure diagram

Drosophila pseudoobscura (Fruit fly) tRNA-Glu URS000048030A_7237

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCAUAUUGUCUAGUGGUUAGGAUACCCGGCUCUCACCCGGGAGGCCCGGGUUCAAUUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 42 other species

  1. Coremacera marginata (Sieve-winged Snailkiller) misc RNA ENSCNRG00005015322.1
  2. Daphnia carinata (Water flea) transfer RNA glutamic acid (anticodon CUC)
  3. Daphnia galeata tRNA
  4. Daphnia magna tRNA-Glu
  5. Daphnia pulex (Common water flea) tRNA-Glu
  6. Daphnia pulicaria (Water flea) tRNA-Glu
  7. Drosophila albomicans (Fruit fly) transfer RNA glutamic acid (anticodon CUC)
  8. Drosophila biarmipes (Fruit fly) transfer RNA glutamic acid (anticodon CUC)
  9. Drosophila busckii (Fruit fly) tRNA-Glu
  10. Drosophila elegans (Fruit fly) tRNA-Glu
  11. Drosophila erecta tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 3)
  12. Drosophila eugracilis (Fruit fly) tRNA-Glu
  13. Drosophila ficusphila (Fruit fly) tRNA-Glu
  14. Drosophila grimshawi tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  15. Drosophila guanche (Fruit fly) tRNA-Glu
  16. Drosophila gunungcola (Fruit fly) transfer RNA glutamic acid (anticodon CUC)
  17. Drosophila hydei (Fruit fly) tRNA-Glu
  18. Drosophila innubila (Fruit fly) tRNA-Glu
  19. Drosophila kikkawai (Fruit fly) tRNA-Glu
  20. Drosophila mauritiana (Fruit fly) tRNA-Glu
  21. Drosophila melanogaster (fruit fly) transfer RNA:Glutamic acid-CTC 2-2 (Dmel_CR30220, Dmel_CR30454, Dmel_CR32460)
  22. Drosophila miranda (Fruit fly) tRNA-Glu
  23. Drosophila mojavensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  24. Drosophila navojoa (Fruit fly) tRNA-Glu
  25. Drosophila obscura (Fruit fly) tRNA-Glu
  26. Drosophila persimilis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12)
  27. Drosophila pseudoobscura pseudoobscura tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 10)
  28. Drosophila rhopaloa (Fruit fly) tRNA-Glu
  29. Drosophila santomea (Fruit fly) tRNA-Glu
  30. Drosophila sechellia tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 3)
  31. Drosophila simulans tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  32. Drosophila subobscura (Fruit fly) tRNA-Glu
  33. Drosophila subpulchrella (Fruit fly) tRNA-Glu
  34. Drosophila suzukii (Fruit fly) tRNA-Glu
  35. Drosophila takahashii (Fruit fly) tRNA-Glu
  36. Drosophila teissieri (Fruit fly) tRNA-Glu
  37. Drosophila virilis tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  38. Drosophila willistoni tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1, tRNA-Glu-CTC-2-2)
  39. Drosophila yakuba tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 5)
  40. Myopa tessellatipennis (Thick-headed flies) misc RNA ENSMTEG00005013154.1
  41. Scaptodrosophila lebanonensis tRNA
  42. Stenomitos sp. tRNA-Glu
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...