Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Daphnia pulicaria (Water flea) tRNA-Glu secondary structure diagram

Daphnia pulicaria (Water flea) tRNA-Glu URS000048030A_35523

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCCAUAUUGUCUAGUGGUUAGGAUACCCGGCUCUCACCCGGGAGGCCCGGGUUCAAUUCCCGGUAUGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Daphnia galeata transfer RNA
  2. Daphnia magna tRNA-Glu
  3. Daphnia pulex tRNA-Glu
  4. Drosophila busckii tRNA
  5. Drosophila erecta tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 3)
  6. Drosophila ficusphila tRNA
  7. Drosophila grimshawi tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 3)
  8. Drosophila guanche tRNA.Glu
  9. Drosophila gunungcola tRNA-OTHER
  10. Drosophila melanogaster (fruit fly) transfer RNA:Glutamic acid-CTC 2-2 (Dmel_CR30220, Dmel_CR30454, Dmel_CR32460)
  11. Drosophila mojavensis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 4)
  12. Drosophila persimilis tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 12)
  13. Drosophila pseudoobscura pseudoobscura tRNA-Glu (CTC) (tRNA-Glu-CTC-1 1 to 10)
  14. Drosophila sechellia tRNA-Glu (CTC) (tRNA-Glu-CTC-3 1 to 3)
  15. Drosophila simulans tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  16. Drosophila virilis tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 4)
  17. Drosophila willistoni tRNA-Glu (CTC) (tRNA-Glu-CTC-2-1, tRNA-Glu-CTC-2-2)
  18. Drosophila yakuba tRNA-Glu (CTC) (tRNA-Glu-CTC-2 1 to 5)
2D structure