Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-miR-152 URS00003AFD9B_9823

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ssc-mir-152: Ssc-mir-152 is a microRNA that has been found to be down-regulated in response to LPS stimulation in porcine PBMCs [PMC7903524]. It is one of the four known miRNAs (along with ssc-miR-122, ssc-miR-129b, and ssc-miR-17-5p) that showed expression changes in response to LPS stimulation [PMC7903524]. Overexpression of miR-17-5p has been shown to inhibit the expression of IL-1β and TNF-α in macrophages [PMC7903524]. Ssc-mir-152 is modestly expressed in porcine PBMCs [PMC7903524]. It has also been found to be down-regulated in pigs susceptible to E. coli F18 infection [PMC3427155]. Ssc-mir-152 has been identified as a potential disease marker for E. coli F18 infection and as a potential regulator of genes such as CREBL1 and HSPA1A [PMC4585011] [PMC3490867]. It is also differentially expressed in different pig breeds, such as the Piétrain breed [PMC3555835]. Ssc-mir-152 is one of the dominant expressed miRNAs in porcine tissues such as duodenum and PPV-infected cells [PMC4545981] [PMC3901342]. It has also been predicted to target FTO, a gene associated with obesity, in castrated male pigs [PMC3901342].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCAUGACAGAACUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis ami-miR-152-3p
  2. Bos taurus Bta-Mir-148-P3_3p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-152
  4. Canis lupus familiaris cfa-miR-152
  5. Cavia porcellus (domestic guinea pig) cpo-miR-152-3p
  6. Cervus elaphus (red deer) cel-miR-152
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P3_3p (mature (guide))
  8. Chrysemys picta cpi-miR-152-3p
  9. Cricetulus griseus cgr-miR-152-3p
  10. Gorilla gorilla gorilla ggo-miR-152 (MIR152)
  11. Gorilla gorilla ggo-miR-152
  12. Homo sapiens hsa-miR-152-3p
  13. Ictidomys tridecemlineatus microRNA miR-152
  14. Macaca mulatta (Rhesus monkey) mml-miR-152-3p
  15. Monodelphis domestica Mdo-Mir-148-P3_3p (mature (guide))
  16. Mus musculus mmu-miR-152-3p
  17. Oryctolagus cuniculus (rabbit) ocu-miR-152-3p
  18. Ovis aries oar-miR-152
  19. Pan troglodytes (chimpanzee) ptr-miR-152
  20. Pongo pygmaeus ppy-miR-152
  21. Pteropus alecto (black flying fox) pal-miR-152-3p
  22. Rattus norvegicus rno-miR-152-3p
  23. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-148-P3_3p (mature (guide))
  24. Sphenodon punctatus (tuatara) Spt-Mir-148-P3_3p (mature (guide))
  25. Tupaia chinensis tch-miR-152
Publications