Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-152-3p URS00003AFD9B_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-152: mmu-mir-152 is a microRNA that has been identified as a regulator for lung non-specific genes [PMC3866260]. It is part of a 9-microRNA group that is down-regulated during the early phase of wound healing and returns to basal levels during the later phase [PMC3665798]. mmu-mir-152 has been found to combine with CaMK II alpha to inhibit the innate immune response induced by DCs, leading to the down-regulation of IL-12, IL-6, TNF-alpha, and IFN-beta synthesis [PMC4136864]. It has also been shown to play a critical role in inducing immune tolerance in liver grafts in a murine model [PMC4136864]. mmu-mir-152 can modify RNA degradation, endocytosis, sphingolipid metabolism, and phosphatidylinositol signaling system [PMC4136864]. Additionally, mmu-mir-152 inhibits DKK1 and is abundantly expressed in hair follicles [PMC8616136]. These findings suggest that mmu-mir-152 may have potential clinical applications as a regulator of immune response and tolerance induction.

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCAUGACAGAACUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis ami-miR-152-3p
  2. Bos taurus Bta-Mir-148-P3_3p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-152
  4. Canis lupus familiaris cfa-miR-152
  5. Cavia porcellus (domestic guinea pig) cpo-miR-152-3p
  6. Cervus elaphus (red deer) cel-miR-152
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P3_3p (mature (guide))
  8. Chrysemys picta cpi-miR-152-3p
  9. Cricetulus griseus cgr-miR-152-3p
  10. Gorilla gorilla gorilla ggo-miR-152 (MIR152)
  11. Gorilla gorilla ggo-miR-152
  12. Homo sapiens hsa-miR-152-3p
  13. Ictidomys tridecemlineatus microRNA miR-152
  14. Macaca mulatta (Rhesus monkey) mml-miR-152-3p
  15. Monodelphis domestica Mdo-Mir-148-P3_3p (mature (guide))
  16. Oryctolagus cuniculus (rabbit) ocu-miR-152-3p
  17. Ovis aries oar-miR-152
  18. Pan troglodytes (chimpanzee) ptr-miR-152
  19. Pongo pygmaeus ppy-miR-152
  20. Pteropus alecto (black flying fox) pal-miR-152-3p
  21. Rattus norvegicus rno-miR-152-3p
  22. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-148-P3_3p (mature (guide))
  23. Sphenodon punctatus (tuatara) Spt-Mir-148-P3_3p (mature (guide))
  24. Sus scrofa ssc-miR-152
  25. Tupaia chinensis tch-miR-152
Publications