Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-152 URS00003AFD9B_9593

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAGUGCAUGACAGAACUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 25 other species

  1. Alligator mississippiensis ami-miR-152-3p
  2. Bos taurus Bta-Mir-148-P3_3p (mature (guide))
  3. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-152
  4. Canis lupus familiaris cfa-miR-152
  5. Cavia porcellus (domestic guinea pig) cpo-miR-152-3p
  6. Cervus elaphus (red deer) cel-miR-152
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-148-P3_3p (mature (guide))
  8. Chrysemys picta cpi-miR-152-3p
  9. Cricetulus griseus cgr-miR-152-3p
  10. Gorilla gorilla gorilla ggo-miR-152 (MIR152)
  11. Homo sapiens hsa-miR-152-3p
  12. Ictidomys tridecemlineatus microRNA miR-152
  13. Macaca mulatta (Rhesus monkey) mml-miR-152-3p
  14. Monodelphis domestica Mdo-Mir-148-P3_3p (mature (guide))
  15. Mus musculus mmu-miR-152-3p
  16. Oryctolagus cuniculus (rabbit) ocu-miR-152-3p
  17. Ovis aries oar-miR-152
  18. Pan troglodytes (chimpanzee) ptr-miR-152
  19. Pongo pygmaeus ppy-miR-152
  20. Pteropus alecto (black flying fox) pal-miR-152-3p
  21. Rattus norvegicus rno-miR-152-3p
  22. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-148-P3_3p (mature (guide))
  23. Sphenodon punctatus (tuatara) Spt-Mir-148-P3_3p (mature (guide))
  24. Sus scrofa ssc-miR-152
  25. Tupaia chinensis tch-miR-152
Publications