Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus familiaris (dog) cfa-miR-30a URS0000361AEA_9615

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

cfa-mir-30a: Cfa-mir-30a is a member of the cfa-miR-30 family, which is one of the miRNAs with the highest activity in the dog pituitary [PMC4768678]. In a study comparing CFDP1_vs_CFDP2, cfa-mir-30a was found to be significantly downregulated [PMC4768678]. In the adrenal cortex, cfa-mir-30a is part of the cfa-miR-30 family, which is one of the most abundant known miRNAs [PMC4768678]. The expression levels of cfa-mir-30a were validated using qPCR [PMC4768678]. Additionally, in dog adrenal cortex and pituitary samples, cfa-mir-30a was found to be one of the miRNAs with highest activity and abundance [PMC4768678]. In veterinary patients with congestive heart failure (CHF), downregulation of cfa-mir-30a has been observed in canine ventricular and atrial muscles after CHF development subsequent to experimental ventricular pacing [PMC5533140]. The genomic region containing cfa-mir-30a has been identified as a potential location for causal genetic variants related to certain conditions [PMC3485664]. Furthermore, in metastatic and non-metastatic mammary tumors, significant differential expression of cfa-mir-30a has been observed [PMC7646326]. References: [PMC4768678] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4768678/ [PMC5533140] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5533140/ [PMC3485664] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3485664/ [PM7646326] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7646326/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAAACAUCCUCGACUGGAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 14 other species

  1. Callithrix jacchus cja-miR-30a
  2. Callorhinchus milii (elephant shark) eshark_mir-30_3
  3. Cricetulus griseus cgr-miR-30a-5p
  4. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-440
  5. Homo sapiens (human) microRNA miR-97
  6. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-4271029
  7. Ornithorhynchus anatinus oan-miR-30a-5p
  8. Ovis aries oar-miR-30a-5p
  9. Petromyzon marinus pma-miR-30a-5p
  10. Pteropus alecto (black flying fox) pal-miR-30a-5p
  11. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63019
  12. Taeniopygia guttata tgu-miR-30b-5p
  13. Xenopus laevis xla-miR-30a-5p
  14. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-2301983
Publications